Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012085462 Xt7.1-CAAL8267.3 - 17 ESTs
                                                                       ....-1250.....-1240.....-1230.....-1220.....-1210.....-1200.....-1190.....-1180.....-1170.....-1160.....-1150.....-1140.....-1130.....-1120.....-1110.....-1100.....-1090.....-1080.....-1070.....-1060.....-1050.....-1040.....-1030.....-1020.....-1010.....-1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL8267.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCTGGGGACATCGGGAAGCACTTCACCAGTCATCAGTACTACACCTCCTGGAGTAGGAGCTTTCAGCCTCCAGGTTCCATCTTTAGCAGCCTCATCTTCTCCAAGGTTACCGACCCCACTTTGTTTTCCCGGTCCCCTATTGGGAGGTCTGCATGAAATACCCTCAGGGTATGGACTGGGGAGCTCTGCTTTTGAGCCTTACACACGTCTGGATAGGAAAGACACTGCTGCAGGCAAGAAGCCAACTTCTTAAAAACATGACTGAATGGAAGGTGTCTGTCTAAGTCGGAAGTGTTGGCTTCCCGGCACCCTGCGCTCAGTGACTGGTGGGAAGTGGGAATTGTCAAAAACTGTTTACCAAAATGTGTCTAGTGGTGTGTGTGTTTGTTTCACGGTTGTAACATAATCTGATATATATGGAGGTTCATTACTGGGCACGAAGAGGCTCTTGAAGCTCAACCAGATGGAAGCACAAATATCATCTCCAGCCAAGTGATCCTTAAGGGGAATCTATCATTACATGAATTCTAGCATCTTATTTCCTTCTAAGCACAGCCTTACGGTTCCTTTGTAGGACACTCTTGTAGCAGAATATAGACCTTGTGGTCCTCAACTGTTACACCATTAAGGTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCAGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATGGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGATTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCAGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGTGGGGTGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTTTACTATGTATGTTGTTTGACAAAAATCCACCGCACAAGTAAATGTTTTAA
                                                  Xt7.1-CHK-1008231630                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACATCGGGAAGCACTTCACCAGTCATCAGTACTACACCTCCTGGAGTAGGAGCTTTCAGCCTCCAGGTTCCATCTTTAGCAGCCTCATCTTCTCCAAGGTTACCGACCCCACTTTGTTTTCCCGGTCCCCTATTGGGAGGTCTGCATGAAATACCCTCAGGGTATGGACTGGGGAGCTCTGCTTTTGAGCCTTACACACGTCTGGATAGGAAAGACACTGCTGCAGGCAAGAAGCCAACTTCTTAAAAACATGACTGAATGGAAGGTGTCTGTCTAAGTCGGAAGTGTTGGCTTCCCGGCACCCTGCGCTCAGTGACTGGTGGGAAGTGGGAATTGTCAAAAACTGTTTACCAAAATGTGTCTAGTGGTGTGTGTGTTTGTTTCACGGTTGTAACATAATCTGATATATATGGAGGTTCATTACTGGGCACGAAGAGGCTCTTGAAGCTCAACCAGATGGAAGCACAAATATCATCTCCAGCCAAGTGATCCTTAAGGGGAATCTATCATTACATGAATTCTAGCATCTTATTTCCTTCTAAGCACAGCCTTACGGTTCCTTTGTAGGACACTCTTGTAGCAGAATATAGACCTTGTGGTCCTCAACTGTTACACCATTAAGGTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCAGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATAGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGATTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCAGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGTGGGGTGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTTTACTATGTATGTTGTTTGACAAAAATCCCCCGCACAAGTAAATGTTTTAAATTTTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     7     4     7     3     6     3     6     3     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     5     6     5     6     5     6     5     7     5     7     4     7     5     7     4     6     4     6     5     6     6     6     7     7     7     7     6     7     6     6     6     6     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----G------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dr ---- 6e-014     NP_919390.1 ventral anterior homeobox 2 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 9e-039     Q9IAX9 Ventral anterior homeobox 2b (Ventral anterior homeobox 3) [Xenopus laevis]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- ?? ---- 9e-039     NP_001081712.1 Vax2 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL8267.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAA---------TGAATG---------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------ATG---------------------------TGA------------------------ATG------------------------------------------------TAG---------------------------------------------------TAA---------TAA------------TAATAG---------------------------------------------------------------------------------TGATAG---------------------------------------ATG---------------------TAA---------------------TAG---------TAA------ATGATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---TAA---TAA---------ATG------TAATAG---TAA---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------TAG---TAA------TAA---------------------------------------------------------------TAA---------------------------TAG------------------------------------------------------TAG------TGA------------------------------------------------------------TGA---------------------------------------------TGA---------------TAA------ATG------------------------------------------------------------ATG---------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                     ]
  5   1   0       add Brn3 5g3  in                         CAAK3417.5p ATATTTGAAAGTCCAACCTGTCAGGGAAAATGCAAAGAAGGATTTTTTTTTCCTGAGCAAGATGATGAACTGTTGGGTCCCGGAGCATACGGAACAGACTTCGGAACACTAACTCGTTCTTAAATATATTTCAAAGACTTGAGAAGTTTTTGGACAGCGGTGATATTACAACTGTCCGAGTCTGACCTCGTAAGAAAAAAATATTCCGAGGAACTTACATACAATTTTTCCCTTTCTTACTTGACTGGACACAAAAAAAGCGGGTCTGCACCTCCGGTACTAAAGAGTATCAGAATTACTTATTTTAAACACATTATACGCCTTAATTTGGCACATTGATTCTAAGATTCATGCCTTTTTTATTTTGGATTTTTGGCCACTGAGCAGTCTGTCAATGTACAAAGAAGACATAAGTTGCCGAAGTGAACCTGTGCTTGTATAGACTTGCTACCATGGCAAGACCTTTAGTGGAATATTTGTGTGGAACCTCTGATGCCCTACATGCATTTGGCTGCTGACTTCTGCCTGCGTGAATTGTGTTTTTTTTTTTTTTCTGGAAGTGTTATTGGCAGGAGGGGGCAGCTTAAGGGTTAGTAGGGGTTCTCTTGATGTTTGATCAAGCTACTAGTATGGGCGATGGAGTGTCCGAGGAGAGAAGCCCTCTGTGTGGGAAATCAGCCACAGAACGAGTCAGAGACAAGGGAACAAGGGCTGATCTGGAGTGCTCCTTGCGAGGCCACAGTCTAAAGGAGAT
  5   1   2       bld TbA       in                   TTbA074h17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTAAGGGTTAGTAGGGGTTCTCTTGACGTTTGATCAAGCTACTAGTATGGGCGATGGAGTGTCCGAGGAGAGAAGCCCTCTGTGTGGCAAATCAGCCACAGAACGAGTCAGAGACAAGGGAACAAGGGCTGATCTGGAGTGCTCCTTGCGAGGCCACAGTCTAAAGGAGATTCCTGTGACCTCCACCTCCAGCCCCGGCTCGTCCAAGGAAGAGGGTCAGGACAGCCAGTCCACAGGAGAAGCTGATTACTGTCGACGGATCCTGGTTAGAGATGCCAAAGGGACGATTAGGGAGATTGTTCTCCCAAAGGGCTTGGATCTGGATCGGCCCAAACGTACCAGAACGTCCTTCACAGCTGAACAGCTTTACCGCCTGGAGCTGGAATTCCAGAGGTGCCAGTATGTTGTTGGCAGAGAGAGGACAGAGCTGGCCAGGCAACTCAATCTGTCGGAAACCCAGGTCAAGGTTTGGTTCCAGAACAGAAGAACGAAACAGAAGAAAGATCAGAGCAGGGACTCTGAGAAACGTTCCTCTTCCACTTCCGAATCCTTCGCTACTTGCAATATTTTGCGATTGTTGGAACAGGGTAGACTTTTGTCGGTCCCGGCCCCACCGAATCTGATCTCCTCTAGTCAAAACAACATGGGCACTTCATCTGGCAACGGAGTCAGCCTGGGGACATCGGGAAGCACTTCACCAGTCATCAGTACTACACCTCCTGGAGTAGGAGCTTTCAGCCTCCAGGTTCCATCTTTAGCAGCCTCATCTTCTCCAAGGTTACCGACCCCACTTTGTTTTCCCGGTCCCCTATTGGGAGGTCTGCATGANATACCCTCAGGGTATGGACTGGGGAGCTCTGCTTTTGAGCCTTACACACGTCTGGATAGGAAAGACACTGCTGCAGG
  3   1   2       bld TbA       in                    TTbA074h17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCAGCCTGGGGACATCGGGAAGCACTTCACCAGTCATCAGTACTACACCTCCTGGAGTAGGAGCTTTCAGCCTCCAGGTTCCATCTTTAGCAGCCTCATCTTCTCCAAGGTTACCGACCCCACTTTGTTTTCCCGGTCCCCTATTGGGAGGTCTGCATGAAATACCCTCAGGGTATGGACTGGGGAGCTCTGCTTTTGAGCCTTACACACGTCTGGATAGGAAAGACACTGCTGCAGGCAAGAAGCCAACTTCTTAAAAACATGACTGAATGGAAGGTGTCTGTCTAAGTCGGAAGTGTTGGCTTCCCGGCACCCTGCGCTCAGTGACTGGTGGGAAGTGGGAATTGTCAAAAACTGTTTACCAAAATGTGTCTAGTGGTGTGTGTGTTTGTTTCACGGTTGTAACATAATCTGATATATATGGAGGTTCATTACTGGGCACGAAGAGGCTCTTGAAGCTCAACCAGATGGAAGCACAAATATCATCTCCAGCCAAGTGATCCTTAAGGGGAATCTATCATTACATGAATTCTAGCATCTTATTTCCTTCTAAGCACAGCCTTACGGTTCCTTTGTAGGACACCCTTGTAGCAGAATATAGACCTTGTGGTCCTCAACTGTTACACCATTAAGGTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATAGCCATTATAGTTATGGGACCATATTACAAGGCGGGCTAAATAGGGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Tad5                                 XZT55029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTCCATCTTTAGCAGCCTCATCTTCTCCAAGGTTACCGACCCCACTTTGTTTTCCCGGTCCCCTATTGGGAGGTCTGCATGAAATACCCTCAGGGTATGGACTGGGGAGCTCTGCTTTTGAGCCTTACACACGTCTGGATAGGAAAGACACTGCTGCAGGCAAGAAGCCAACTTCTTAAAAACATGACTGAATGGAAGGTGTCTGTCTAAGTCGGAAGTGTTGGCTTCCCGGCACCCTGCGCTCAGTGACTGGTGGGAAGTGGGAATTGTCAAAAACTGTTTACCAAAATGTGTCTAGTGGTGTGTGTGTTTGTTTCACGGTTGTAACATAATCTGATATATATGGAGGTTCATTACTGGGCACGAAGAGGCTCTTGAAGCTCAACCAGATGGAAGCACAAATATCATCTCCAGCCAAGTGATCCTTAAGGGGAATCTATCATTACATGAATTCTAGCATCTTATTTCCTTCTAAGCACAGCCTTACGGTTCCTTTGTAGGACACTCTTGTAGCAGAATATAGACCTTGTGGTCCTCAACTGTTACACCATTAAGGTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCAGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAANAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAAT
  5   1   2       bld Eye       in                         CCAX2951.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAACATAATCTGATATATATGGAGGTTCGTTACTGGGCATTAAGAGGCTCTTGAAGCTCAACCAGATGGAAGCACAAATATCATCTCCAGCCAAGTGATCCTTAAGGGGAATCTATCATTACATGAATTCTAGCATCTTATTTCCTTCTAAGCACAGCCTTACCGTTCCTTTGTAGCACACCCTTGTAGCAGAATATAGACCTTGTGGTCCTCAACTGTTACACCATTAAGGTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCGGGCTAATGTAATGGCC
  5   1   2       bld Brn4      in                         CAAL8267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTCATTACTGGGCACGAAGAGGCTCTTGAAGCTCAACCAGATGGAAGCACAAATATCATCTCCAGCCAAGTGATCCTTAAGGGGAATCTATCATTACATGAATTCTAGCATCTTATTTCCTTCTAAGCACAGCCTTACGGTTCCTTTGTAGGACACTCTTGTAGCAGAATATAGACCTTGTGGTCCTCAACTGTTACACCATTAAGGTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCAGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAACCACGGGCCCTAGTGGTCCCCTCTA
  5   1   2       bld TpA       in                   TTpA078a09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGTCCTCAACTGTTACACCATTAAGGCTTTCCATTAAACAATATACAGGTAATAGAAGGTTCTAGATGGAATTAGAGAATTCAGCGCTCCAATAAACTATTACTCTCAAATATATCTCTGCAATTCCGTATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCAGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATAGTAGCCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCACGCTTCT
  5   1   2       bld Eye       in                         CCAX7795.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTAGTTTGATAGATTCCCTTTAATCATTCATACAACATTGCCATTATAGTTATGGGACCATATTACAAGGCGGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATGGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGAT
  5   1   2       bld Eye       in                         CCAX2162.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATATTACAAGGCGGGCTAATGTAATGGCCAAGATTATTGGTAGATAAGTGTTTAAAAAAAAAATGATGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATGGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCC
  5   1   2       bld Eye       in                         CCAX6976.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAAATGCATTATTTATTTCAGATTTACAGCTTGCCAAATGTGTCTAATATTGTTGGTGGGAGGGGGCGGGGCAATGGAATAAAGGGGCAGTTCACGTTTTGTAAAAATGTTTCAATACGACGCAATCATGGCCACAGTAGAACGATTCATGTGTTTTTGGTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATGGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGAGTCTCTCTAGAACCA
  3   1   2      seed Brn4      in                         CAAL8267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTAGAACGATTCATGTGTTTTTGTTTTCCAGTTCTACAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACCTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATAGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGATTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCGGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTT
  3   1   2       bld Brn3 5g3  in                         CAAK3417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTCTGGTGTTTCAGCTGGCATCTAGTTGCCAGGCACNTGAAGAGTAGCAACTGGGCAGAGATTGGAATACCAGAGTGGAGGATGACCTAAACATAAAGATATGTCATGGAAAAATAATAGCAATAAAACTGTAGGACTGCAATTAGTTTTCTGGTCAAGTTGACAGGCACCAAAAAGAAAAGGGAGGAACCAACTGCTACTGGGTCGGAATACAAAACCACGGGCCCTAGTGGTCCCCTCTATGGTATAATGCCCATCAGTTCATTATTACTTATTCCCAAAAGCCATAGTAGCCCCGGAGGTCAAGTTCTCTGTTGGGCTTTAGAATGTCCAGCCAACACGGAATTGCTAAGATACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGATTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCGGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAAT
  3   1   2       bld Eye       in                         CCAX7795.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACCTTTCAACGCTTCTACCAAGTGATAGGGTAGTCATTCCACTGACTTGGTAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGAGTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCAGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGTGGGGTGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTCTACTATGTATGTTGTTTGACAAAAATCCACCGCACAAGTAAATGTCTTAAATTTTCAACTG
  3   1   2       bld Eye       in                         CCAX6976.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAAAAAACAAGGCAATAGGGTTGTCTAAAAAAATCTTTAATTATCCCCCTGATCCTAAATGAAAGCAGCAAGCCCCTCCCACCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGAGTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCAGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGTGGGGTGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTTTACTATGTATGTTGTTTGACAAAAATCCCCCGCACAAGTAAATGTTTTAAATTTTCAACTG
  3   1   2       bld Eye       in                         CCAX2162.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCCCCTCCCCCCCTACGTGTAACATTAATGTAGCATTATTGGGATCACTGATATGGAGTCTTTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTTTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCAGACCCCCCTGTACGTCGGAAAATGTTTTTTTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTTTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGTGGGGTGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTTTACTATGTATGTTGTTTGACAAAAATCCCCCGCACAAGTAAATGTTTTAAATTTTCAACTG
  3   1   2       bld TpA       in                   TTpA078a09.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTAACATTAATGTAGCATTATTGGGATCACTGATATGGATTCTCTCTAGAACCATTGAGACAAGAGAGAGATCCTTCTGGGCTTCCTCTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTACAAATGCACTAGCCTGGCGACCGGACCCCCCTGTACGTCGGAAAATGTTTTTCTGTTGTAAAGTTCTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGTGGGGTGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTCTACTATGTATGTTGTTTGACAAAAATCCACCGCACAAGTAAATGTCTTAAATTTTCAACTGAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Eye       in                         CCAX2951.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGATCCTTCTGGGCTTCCTCTTCAGTATTTAATTAGCCCGGGACGATGCATTTGATTGCCAAGGTCGTTATAGTTCTAACTAAAATAAATCTCCAAATGCACTAGCCTGGGGACCAGACCCCCCTGTACGTCGGAAAATGTTTTTTTGTTGTAAAGTTTTTTGCAATGTAATGACGATGAATAGTCTATTGGAATCAAATATATACAGATTTACTTTACTAATAATATTTTCTTACACTAGTGTTTGTGATGTGTGCCGCTCAGTCAGTGCTATGAGCCGGAAACAAACAAAAAAAAAGAAGTCTTGACCTGAAGAGCTTTTAATATTGGGGGGGGGGGGCAAGGATATGATGTAACTTGACTCAAGAACCAATGGTAATGCAATATGTGGTCAGCTGACAAGCGTTGGGATTCCAAGGCTACGAGACTGGCCAACGGGCATTTTACTATGTATGTTGTTTGACAAAAATCCCCCGCCCAAGTAAATGTTTTAAATTTTCAACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)