Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA003j07.3                          2 END     2          25      100                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012085609 Xt7.1-CBXT4960.5 - 8 ESTs
                                                                       ...-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT4960.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCTACTGGAATAGTGCCAACCTTACGGAATGGACACATGTCCCCTGACACAGACAATGATACAACAGATAACCCGATAACAAAACTGATGCCCTTGGGAGTCAACAGGGAAAATGAGATGGAAGAAGTAATTGATGACATAATTAGCCTAGAATCAAGTTTCAATGATGATGGCTTGAACTGCACAGAACCCACACTGTTGATGTCAAGTAATCTTCCACTCTCAAGCAGTATTCTGGATCTTTACAACAGTGACCAAAGCTCTGACATGGGACTTTCAAATAATGCCTGCCCTAGTCTTGGAGTAAAAAGGGAAGCTACAGACACAGATAATCGAGCCATGGCAAAAGAAAGACAGAAAAAGGACAACCATAATCTCATTGAGCGACGGAGGAGATACAATATTAACTACAGAATTAAAGAACTTGGAACACTAATCCCAAAATCTAATGATCCTGATATGCGCTGGAACAAAGGGACTATTTTAAAAGCTTCGGTAGAATACATCAAATGGCTACAAAAAGAACAACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATATGGGGAAGATATGTCTCAGGATTTTGCTTCTCAGCTTCCAGTTTCCATTGGACAAACGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCATGAGGGCAACTTTTTTACTTTGTAAATATTGGTCAGAAAGCAGAGAACAAAACATTTCTTGCAATTACATTATATCTGTTTAATGAAAGGACACCTTTCCCACTTATCTTATTTTGTAGTGTATATATATATTATTTTTTCATAATGTACATTTGAATCAG
                                                  Xt7.1-CHK-1008238443                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAATAGTGCCAACCTTACGGAATGGACACATGTCCCCTGACACAGACAATGATACAACAGATAACCCGATAACAAAACTGATGCCCTTGGGAGTCAACAGGGAAAATGAGATGGAAGAAGTAATTGATGACATAATTAGCCTAGAATCAAGTTTCAATGATGATGGCTTGAACTGCACAGAACCCACACTGTTGATGTCAAGTAATCTTCCACTCTCAAGCAGTATTCTGGATCTTTACAACAGTGACCAAAGCTCTGACATGGGACTTTCAAATAATGCCTGCCCTAGTCTTGGAGTAAAAAGGGAAGCTACAGACACAGATAATCGAGCCATGGCAAAAGAAAGACAGAAAAAGGACAACCATAATCTCATTGAGCGACGGAGGAGATACAATATTAACTACAGAATTAAAGAACTTGGAACACTAATCCCAAAATCTAATGATCCTGATATGCGCTGGAACAAAGGGACTATTTTAAAAGCTTCGGTAGAATACATCAAATGGCTACAAAAAGAACAACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATATGGGGAAGATATGTCTCAGGATTTTGCTTCTCAGCTTCCAGTTTCCATTGGACAAACGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCATGAGGGCAACTTTTTTACTTTGTAAATATTGGTCAGAAAGCAGAGAACAAAACATTTCTTGCAATTACATTATATCTGTTTAATGAAAGGACACCTTTCCCACTTATCTTATTTTGTAGTGTATATATATATTATTTTTTCATAATGTACATTTGAATCAGATTTTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4
                                                                                                           PROTEIN --- Sc ---- 6e-009     NP_009447.1 Basic helix-loop-helix-leucine zipper (bHLH/Zip) transcription factor that forms a complex with another bHLH/Zip protein, Rtg1p, to activate the retrograde (RTG) and TOR pathways [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-024     NP_001023416.1 W02C12.3h [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 5e-032     NP_001015077.1 CG17469-PA.3 [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                  PREDICTED - Sp ---- 1e-038     XP_783071.2 PREDICTED: similar to IGHM enhancer 3a-binding transcription factor [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 6e-043     BAE06557.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Xt ---- 6e-074     AAI35969.1 Unknown (protein for MGC:122210) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- ?? ---- 6e-074     NP_001093747.1 microphthalmia-associated transcription factor [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Xl ---- 7e-075     BAD08296.1 micophthalmia-associated transcription factor type A [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 2e-084     NP_112475.1 transcription factor EC [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Dr ---- 6e-088     NP_001025276.1 hypothetical protein LOC556894 [Danio rerio] -----------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 2e-107     NP_036384.1 transcription factor EC [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Gg ---- 8e-123     NP_001006229.1 transcription factor EC [Gallus gallus] ----------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT4960.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------------------------------TAAATG---------------------------------------------------------------------------------------------TAG------ATG------------------------------------------------TAA---TGA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------ATG------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2       bld Int1      in                        CAAP13299.5p                                                                                                                                                                                                                                                                                                                                                                 TGTACTTCACAAAGATGGTAACCCTGATACAAATCCACTCCGTTCCGGTTCAAGCTCACTTGGAGAACCCAACAAAATATCATTTACAGCAATCACAAAGGCAACAAGTTAAACAATATCTGAACCTTGGGAACAAATTTTCAACCCAGACACTTTCATATTCCCACCCACATGCTATTCAACCTACTGGAATAGTGCCAACCTTACGGAATGGACACATGTCCCCTGACACAGACAATGATACAACAGATAACCCGATAACAAAACTGATGCCCTTGGGAGTCAACAGGGAAAATGAGATGGAAGAAGTAATTGATGACATAATTAGCCTAGAATCAAGTTTCAATGATGATGGCTTGAACTGCACAGAACCCACACTGTTGATGTCAAGTAATCTTCCACTCTCAAGCAGTATTCTGGATCTTTACAACAGTGACCAAAGCTCTGACATGGGACTTTCAAATAATGCCTGCCCTAGTCTTGGAGTAAAAAGGGAAGCTACAGACACAGATAATCGAGCCATGGCAAAAGAAAGACAGAAAAAGGACAACCATAATCTCATTGAGCGACGGAGGAGATACAATATTAACTACAGAATTAAAGAACTTGGAACACTAATCCCAAAATCTAATGATCCTGATATGCGCTGGAACAAAGGGACTATTTTAAAAGCTTCGGTAGAATACATCANATGGCTACAAAAAGAACAACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATAT
  5   1   2       bld HdA       out                  THdA003j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACATGCTATTCACCTACTGGAATAGTGCCAACCTTACGAAATGGACACATGTCCCCTGACACAGACAATGATACAACAGATAACCCGATAACAAAACTGATGCCCTTGGGAGTCAACAGGGAAAATGAGATGGAAGAAGTAATTGATGACATAATTAGCCTAGAATCAAGTTTCAATGATGATGGCTTGAACTGCACAGAACCCACACTGTTGATGTCAAGTAATCTTCCACTCTCAAGCAGTATTCTGGATCTTTACAACAGTGACCAAAGCTCTGACATGGGACTTTCAAATAATGCCTGCCCTAGTCTTGGAGTAAAAAGGGAAGCTACAGACACAGATAATCGAGCCATGGCAAAAGAAAGACAGAAAAAGGACAACCATAATCTCATTGAGCGACGGAGGAGATACAATATTAACTACAGAATTAAAGAACTTGGAACACTAATCCCAAAATCTAATGATCCTGATATGCGCTGGAACAAAGGGACTATTTTAAAAGCTTCGGTAGAATACATCAAATGGCTACAAAAAGAACAACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCT
  5   1   2       bld TbA       out                  TTbA025l07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAGGAATGGGAGAGACTTGTTGCAGGACAGGTTAAACTGGGGAGAAATTTCCAGCTTCCACTCTCAAGCAGTATTCTGGATCTTTACAACAGTGACCAAAGCTCTGACATGGGACTTTCAAATAATGCCTGCCCTAGTCTTGGAGTAAAAAGGGAAGCTACAGACACAGATAATCGAGCCATGGCAAAAGAAAGACAGAAAAAGGACAACCATAATCTCATTGAGCGACGGAGGAGATACAATATTAACTACAGAATTAAAGAACTTGGAACACTAATCCCAAAATCTAATGATCCTGATATGCGCTGGAACAAAGGGACTATTTTAAAAGCTTCGGTAGAATACATCAAATGGCTACAAAAAGAACAACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATATGGGGAAGATATGTCTCAGGATTTTGCTTCTCAGCTTCCAGTTTCCATTGGACAAACGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGGATGATCTTTTAAATGANAACACAAAAATTTGAAAATGAAAGACTACATT
  5   1   2      seed Tbd1      in                         CBXT4960.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAAAGGACAACCATAATCTCATTGAGCGACGGAGGAGATACAATATTAACTACAGAATTAAAGAACTTGGAACACTAATCCCAAAATCTAATGATCCTGATATGCGCTGGAACAAAGGGACTATTTTAAAAGCTTCGGTAGAATACATCAAATGGCTACAAAAAGAACAACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATATGGGGAAGATATGTCTCAGGATTTTGCTTCTCAGCTTCCAGTTTCCATTGGACAAACGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCAT
  5   1   2       bld HdA       in                  THdA030f16.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACACAAAAAGGTCGAGAATTAGAACACAGGCAGAAAAAATTAGAACAAGCTAACAGAAGATTGCTGCTTCGTATTCAGGAACTAGAAATACAAGCTCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATATGGGGAAGATATGTCTCAGGATTTTGCTTCTCAGCTTCCAGTTTCCATTGGACAAACGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCATGAGGGCAACTTTTTTACTTTGTAAATATTGGTCAGAAAGCAGAGAACAAAACATTTCTTGCAATTACATTATATCTGTTTAATGAAAGGACACCTTTCCCACTTATCTTATTTTGTAGTGTATATATATNATTATTTTTTCATAATGTACATTTGAATCAGATTTTCATGTTATGGTTTACGCTTTAAGGAAATACATTTAGTCCTTACTCATCT
  3   1   2       bld Tbd1      in                         CBXT4960.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGAGCCCACGGCCTTCCTATGCCAACATTATGTACGGTGGAAATAGCTTCCCAAGTCATCAAGCAGCAAACATATGGGGAAGATATGTCTCAGGATTTTGCTTCTCAGCTTCCAGTTTCCATTGGACAAACGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCATGAGGGCAACTTTTTTACTTTGTAAATATTGGTCAGAAAGCACCAAAACATTTCTTGCAATTACATTATATCTGTTTAATGAAAGGACACCTTTCCCACTTATCTTATTTTGTAGTGTATATATATATTATTTTTTCATAATGTACATTTGAATCAGATTTTCATGTTATGGTTTACGCCTTAAGGAAATACATTTAGTCCTTACTCATCTAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA030f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCATGAGGGCAACTTTTTTACTTTGTAAATATTGGTCAGAAAGCAGAGAACAAAACATTTCTTGCAATTACATTATATCTGTTTAATGAAAGGACACCTTTCCCACTTATCTTATTTTGTAGTGTATATATATATTATTTTTTCATAATGTACATTTGAATCAGATTTTCATGTTATGGTTTAGCGCTTTAAGGAAATACATTTAGTCCTTACTCATCAAAAAAAAAAAAAAAAAAGCGC
  3   1   2       bld Int1      in                        CAAP13299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCAGACTTGTGTGATGTATCTACATCATTTTCAGACCCACTATCACATTTCACAGATCTATCCTTTAGCGCAGCTTTAAAAGAGCAAATGTTGGAAGAAATGTCACCCTATGGAGCTGATCCCTTTCTTTCGGCAACATCACCAGACCTATCCAAAGGCAGCAGCAGAAGAAGCAGCTTCAGCACAGATGATGGGGATGATCTTTAAATGAAAACACAAAAATTTGAAAATGAAAGACTACATTGCTTTGGGATACAGTTCTATTTTAAATGTGAGCGTGGGTCCAATCTTTATATTTTTACGTAGGAAAACATGGCCTCTAACAACTATAGCCTATTAAATAAGAAGCCCAAAGGTGTCATCTAATTATGAGAAGATTCATGAGGGCAACTTTTTTACTTTGTAAATATTGGTCAGAAAGCAGAGAACAAAACATTTCTTGCAATTACATTATATCTGTTTAATGAAAGGACACCTTTCCCACTTATCTTATTTTGTAGTGTATATATATATTATTTTTTCATAATGTACATTTGAATCAGATTTCCTCTCGCCCTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)