Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ12656.3                           5 END     1          14       20                (no blast hit)
     2   2.0    0Xt7.1-CAAJ12656.5                           4 END     1          14       33                cut-like 2 [Homo sapiens]
     3   2.0    0Xt7.1-CAAN9613.5                            3 END     2          28       66                PREDICTED: similar to KIAA0293 [Gallus gallus]
     4   2.0    0Xt7.1-CAAM8843.5                            2 END     1          14       50                PREDICTED: similar to KIAA0293 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012085673 Xt7.1-CAAM8843.3 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM8843.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGTTGTGATTCTTGTAGCTCTGAACACACATTGTGTTGTGAAACAGATCCAAGCAGAATGCATAGAGAAGATGAAGCTGCCCAACACTGTGTCGACCTTCAGAGACCACATTATCTAAGAAGAAGCAGTTCTTTTTATGATAAGTTGCGTCCTTCTAGTGCGCATGACTGTTCTCATAAGGAAATTACAAACCCAGAACGGTCACAGACTGACCCAATTAGCTTTAAATCCACAGCAGAATCTTCACGAAGCAGCCTGGAAGTGTCTCTAAACTCTCCTTCAGCTGCCTCCTCTCCTGGCCTAATGATGTCTGTGTCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTTATTACCAACCTGGGGCTGCTTTGATAACAGATAATTATAACATGACAGATGTGTAGCAGTGATGGTTCAGTGTATAGCGTGTTCCTGTAGCTTGCCACTGGATGAGATTAAAATTCCGCTTAAGCCATTGTTGAAGCACTAGAAGAATGACCAAACAAAGTATGTTTCAAGAGGCGTTCTAATCCTGCAGCTGTCTCTAAGACAACCTATTTCCCCCCAAATGGAACAGTCTGAAAGACTCTAAATTCCAAATGGGAAGCCATCATGTGTGACTTGATTCATTGGTCCATTTGATAAAAATCTATCA
                                                  Xt7.1-CHK-1008239030                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGATTCTTGTAGCTCTGAACACACATTGTGTTGTGAAACAGATCCAAGCAGAATGCATAGAGAAGATGAAGCTGCCCAACACTGTGTCGACCTTCAGAGACCACATTATCTAAGAAGAAGCAGTTCTTTTTATGATAAGTTGCGTCCTTCTAGTGCGCATGACTGTTCTCATAAGGAAATTACAAACCCAGAACGGTCACAGACTGACCCAATTAGCTTTAAATCCACAGCAGAATCTTCACGAAGCAGCCTGGAAGTGTCTCTAAACTCTCCTTCAGCTGCCTCCTCTCCTGGCCTAATGATGTCTGTGTCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTTATTACCAACCTGGGGCTGCTTTGATAACAGATAATTATAACATGACAGATGTGTAGCAGTGATGGTTCAGTGTATAGCGTGTTCCTGTAGCTTGCCACTGGATGAGATTAAAATTCCGCTTAAGCCATTGTTGAAGCACTAGAAGAATGACCAAACAAAGTATGTTTCAAGAGGCGTTCTAATCCTGCAGCTGTCTCTAAGACAACCTATTTCCCCCCAAATGGAACAGTCTGAAAGACTCTAAATTCCAAATGGGAAGCCATCATGTGTGACTTGATTCATTGGTCCATTTGATAAAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                               BLH MIN     194      14                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 3e-024     XP_426977.1 PREDICTED: similar to Homeobox protein Cux-2 (Cut-like 2), partial [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 7e-030     NP_031830.2 cut-like 2 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-036     XP_693902.1 PREDICTED: similar to cut-like 2 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-037     NP_056082.2 cut-like 2 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM8843.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TGA---------TAA------------------TAA---------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------TAA---------------------------------TGATAA---------------TGA---ATG------------------------------------TAG------------TGA---TAA---------TAA------------------------TGA---------------------------------------------------------------------------------TGA------------------------------ATG------------------------TGATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       bld Te5       in                         CAAO3525.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTGGTTCCATAACTACAGGTCACGCATGCGCAGGGATATCCTGATAGAGGGTCAGCAGGACAATGACACTGATCAAGAGCCAAGCAGCTGTGATAGTTTCACATCAGTATGTACCTTACACAGGGATCCAGCTCTGCACAGCCTGGCCTCTGAAGGTGTTGATAGAAAACCAGTAGTTTGTGACATGGATCACCTAATGCACAACGATGGTTGCACTGAAGAGAGAGTGGCTACAAGGGAAATTAAGAAAGAGAACATAGAAGAAGGAGAAGAAGAAAAGGATGACTCTTCTAAACGTTGTGATTCTTGTAGCTCTGAACACACATTGTGTTGTGAAACAGATCCAAGCAGAATGCATAGAGAAGATGAAGCTGCCCAACACTGTGTCGACCTTCAGAGACCACATTATCTAAGAAGAAGCAGTTCTTTTTATGATAAGTTGCGTCCTTCTAGTGCGCATGACTGTTCTCATAAGGAAATTACAAACCCAGAACGGTCACAGACTGACCCAATTAGCTTTAAATCCACAGCAGAATCTTCACGAAGCAGCCTGGAAGTGTCTCTAAACTCTCCTTCAGCTGCCTCCTCTCCTGGCCTAATGATGTCTGTGTCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACAGA
  3   1   2      seed Te3       out                        CAAM8843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACGTTGTGATTCTAGTAGCTCTGAACACACATTGTGTTGTGAAACAGATCCAAGCAGAATGCATAGAGAAGATGAAGCTGCCCAACACTGTGTCGACCTTCAGAGACCACATTATCTAAGAAGAAGCAGTTCTTTTTATGATAAGTTGCGTCCTTCTAGTGCGCATGACTGTTCTCATAAGGAAATTACAAACCCAGAACGGTCACAGACTGACCCAATTAGCTTTAAATCCACAGCAGAATCTTCACGAAGCAGCCTGGAAGTGTCTCTAAACTCTCCTTCAGCTGCCTCCTCTCCTGGCCTAATGATGTCTGTGTCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTTATTACC
  3   1   2       bld Te4       out                        CAAN9613.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAGAAGCAGTTCTTTTTATGATAAGTTGCGTCCTTCTAGTGCGCATGACTGTTCTCATAAGGAAATTACAAACCCAGAACGGTCACAGACTGACCCAATTAGCTTTAAATCCACAGCAGAATCTTCACGAAGCAGCCTGGAAGTGTCTCTAAACTCTCCTTCAGCTGCCTCCTCTCCTGGCCTAATGATGTCTGTGTCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTT
  3   1   2       bld Te3  FL   out                        CAAM5167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAAGCAGTTCTTTTTATGATAAGTTGCGTCCTTCTAGTGCGCATGACTGTTCTCATAAGGAAATTACAAACCCAGAACGGTCACAGACTGACCCAATTAGCTTTAAATCCACAGCAGAATCTTCACGAAGCAGCCTGGAAGTGTCTCTAAACTCTCCTTCAGCTGCCTCCTCTCCTGGCCTAATGATGTCTGTGTCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATT
  3   1   2       bld Te3       out                       CAAM14320.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCCTGTCCCTACTTCCTCTGCGCCCATTTCTCCATCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTTATTACCAACCTGGGGCTGCTTTGATAACAGATAATTATAACATGACAGATGTGTAGCAGTGATGGTTCAGTGTATAGCGTGTTCCTGTAGCTTGCCACTGGATGAGATTAAAATTCCGCTTAAGCCATTGTTGAAGCACTAGAAGAATGACCAAACAAAGTATGTTTCAAGAGGCGTTCTAATCCTGCAGCTGTCTCTAAGACAACCTATTTCCCCCCAAATGGAACAGTCTGAAAGACTCTAAATTCCAAATGGGAAGCCATCATGTGTGACTTGATTCATTGGTCCATTTGATAAAAATCTATCATAT
  3   1   2       bld Te5       in                         CAAO3525.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCCCTGCCTAACACTGTTTCAGTAAAACTTCATAAACTGAACACTGCCAGTGACAATGCCCCATTACACCTATCCATAAAACATAGTCCCAACAACCAGAGGAGAAATGAGAAGATGGCCAATTTAAATAACATTATCCACAGGCTCGAGAGAGCAGCAAATAAGGAGGAGACCCTGGAATGGGAATTTTGAAAAATAACCTAAAGACACAGTATCTTTTTGTAACAAACTGGAACCAAGTAAAGCAGAGTGCTTGCAGAGAACATATATGGGATAATTTATATTTTATGGTTCTTGTTTTGTGAAGTAGAAGCTTATGAGAACAAGAGTTTAGAAAACAAACTACTTCCAAAAATTCCATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTTATTACCAACCTGGGGCTGCTTTGATAACAGATAATTATAACATGACAGATGTGTAGCAGTGATGGTTCAGTGTATAGCGTGTTCCTGTAGCTTGCCACTGGATGAGATTAAAATTCCGCTTAAGCCATTGTTGAAGCACTAGAAGAATGACCAAACAAAGTATGTTTCAAGAGGCGTTCTAATCCTGCAGCTGTCTCTAAGACAACCTATTTCCCCCCAAATGGAACAGTCTGAAAGACTCTAAATTCCAAATGGGAAGCCATCATGTGTGACTTGATTCATTGGTCCATTTGATAAAAATCTATCATAT
  5   1   2       bld Brn2      out                       CAAJ12260.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGAATGAAAAAAATATTGACTTTGTTTTCATGTTAAAAAGTAATTCTTTTAGAAGAAAAGATATTTATAAACATTTTAGATATTTTATTAAATAATATTTGGAATTTATTACCAACCTGGGGCTGCTTTGATAACAGATAATTATAACATGACAGATGTGTAGCAGTGATGGTTCCGTGTATAGCGTGTTCCTGTAGCTTGCCACTGGATGAGATTAAAATTCCGCTTAAGCCATTGTTGAAGCACTAGAAGAATGACCAAACAAAGTATGTTTCAAGAGGCGTTCTAATCCTGCAGCTGTCTCTAAGACAACCTATTTCCCCCCAAATGGAACAGTCTGAAAGACTCTAAATTCCAAATGGGAAGCCATCATGTGTGACTTGATTCATTGGTCCATTTGATAAAAATCTATCATATAGTTCTGTGTAGTGTTTATATGTTGTGGAGATGCCAGTTGGACAGCACAGGGTCAAAACATTATTTCACCAATTATTTAAGAGGTTGAAACACAATGCAACATTCCTACCAACATCCCCCACTGGTAGTTTGTCACTCACATGGCTATGTCCTTTCTCTCTCTCACTCTCTCTCTAGGCCATGGGGACCTGTGGTGTCACAGTAACCATACAGGGCATGGTTACTTCCTTTCTAAATTGTTTGGTAAAACAGCTGATAGAGGGAGTACACCTGGAGATACTTTCTTCTTGTGGGACCACTGATAAACTTTCCTGGTGCATGCAGTGAAAAATATGGACTGCCCTTGGAAATGTAAGCATTTGGTAGTTATGCAGGCACAGTGTAATATAAGTCAGGCCGGACTGGNCATCTATGGATTCTGGCAAATGCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)