Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012085687 Xt7.1-TGas125k11.3 - 13 ESTs
                                                                       .-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas125k11.3                                                                                                                                                                                                                                                                                                              TTTTGAGACCAGCTTAATGTGGAAGAGATCAGTGTGGAGGGTACAAGAACGAACATTTGGTTCATTTCCCTACACTGAATGCGGATATAGTTAGAGCTGTCAACCGGACTTAAGCCAATTGCCTGACACCCCACCTCCCCCGTCAAACTGAATGGCTCTTCACAATCCCACTTCTACGGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTCAGAACATTGAGCAAGGGGAGGTCCTAATCTGGGAAGAAGCCTTTGCTAGTGTCATTATTCCAGAGAGAAAACAATGGAGAAAGGAAATAAAATGGGATACCAGAATTACAGCTTGTGATCATTACTGTCACTACTGCTTGAATAGAGTCATAGCTTCCCTGCCCTGTCAGTATTGCAGTTTTGCCAGATACTGTAGTCAGGAGTGTATGGATAAGGCCTGGAGAAGTTACCACTATATCGAGTGTTCAATGGGTGACCTGTTACTTGCTCTGGGGATGTTTTGCCACACAGCACTTAGGGCAGTTCTTGTAGCAGGCTGCAGGCTCTTTTCTCAGTCGTTAGAGCAGACTGGGTCTGCAGATGCCACTGATAAAACTAAAGTCTGCAATAGCAAAAATACCTATCATGAAAAGTATTGCAGTTCCTACCAGTCTGTAGTCAATCTACTCCCGCACACTGAAAATCACCCGGCTGAGAGAAAGTTTCTCTGTGGACTCACTGCTGCAGCTTTGTACAAAAAACTGTGCTTGATAATGGCAAAGGATTTGGTGAGTTCCACATCACAGACAGAGAAATCCTTGACAAAAGAGTCCGGTACTATTGAAGACTGGTCCTCTGTGAGGCAATTCCTTGGTCCAACAGTACTCCGTCATATGCTGCAGCTCTATTGTAATGCACAAGCAGTGACAGCGCTCCAAGAGAATGAAGATGAGAGCAGTTTGTCGCTTGTGAAGAGCAACAAGAGCATTCGTCTTGCCACTGCAGTATTTCCTGTGCTGAGCCTGCTAAATCATTCCTGTGACCCCAATACCACTGTGTCATTTACGGGAAGGTTCGTTACGGTCAGAGCTAATAGGCCAATTAGGAGAGACGAGGAAGTGACACACTGCTATGGTCCCCACAAATTAAGAATGGATGTGGCTGAGAGGCAACAGTTACTGAAGGATCAATATTTTTTTGTGTGCCAGTGTAAAGCATGTACGGAGGAGTTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGAT
                                                  Xt7.1-CHK-1008233812                                                                                                                                                                                                                                                                                                                    GACCAGCTTAATGTGGAAGAGATCAGTGTGGAGGGTACAAGAACGAACATTTGGTTCATTTCCCTACACTGAATGCGGATATAGTTAGAGCTGTCAACCGGACTTAAGCCAATTGCCTGACACCCCACCTCCCCCGTCAAACTGAATGGCTCTTCACAATCCCACTTCTACGGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTCAGAACATTGAGCAAGGGGAGGTCCTAATCTGGGAAGAAGCCTTTGCTAGTGTCATTATTCCAGAGAGAAAACAATGGAGAAAGGAAATAAAATGGGATACCAGAATTACAGCTTGTGATCATTACTGTCACTACTGCTTGAATAGAGTCATAGCTTCCCTGCCCTGTCAGTATTGCAGTTTTGCCAGATACTGTAGTCAGGAGTGTATGGATAAGGCCTGGAGAAGTTACCACTATATCGAGTGTTCAATGGGTGACCTGTTACTTGCTCTGGGGATGTTTTGCCACACAGCACTTAGGGCAGTTCTTGTAGCAGGCTGCAGGCTCTTTTCTCAGTCGTTAGAGCAGACTGGGTCTGCAGATGCCACTGATAAAACTAAAGTCTGCAATAGCAAAAATACCTATCATGAAAAGTATTGCAGTTCCTACCAGTCTGTAGTCAATCTACTCCCGCACACTGAAAATCACCCGGCTGAGAGAAAGTTTCTCTGTGGACTCACTGCTGCAGCTTTGTACAAAAAACTGTGCTTGATAATGGCAAAGGATTTGGTGAGTTCCACATCACAGACAGAGAAATCCTTGACAAAAGAGTCCGGTACTATTGAAGACTGGTCCTCTGTGAGGCAATTCCTTGGTCCAACAGTACTCCGTCATATGCTGCAGCTCTATTGTAATGCACAAGCAGTGACAGCGCTCCAAGAGAATGAAGATGAGAGCAGTTTGTCGCTTGTGAAGAGCAACAAGAGCATTCGTCTTGCCACTGCAGTATTTCCTGTGCTGAGCCTGCTAAATCATTCCTGTGACCCCAATACCACTGTGTCATTTACGGGAAGGTTCGTTACGGTCAGAGCTAATAGGCCAATTAGGAGAGACGAGGAAGTGACACACTGCTATGGTCCCCACAAATTAAGAATGGATGTGGCTGAGAGGCAACAGTTACTGAAGGATCAATATTTTTTTGTGTGCCAGTGTAAAGCATGTACGGAGGAGTTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                   2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     5     6     5     6     5     6     5     6     4     6     4     5     4     5     4     5     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     4     5     4     5     4     5
                                               BLH ATG     194     442                                                                                                                                                                                                                                                                                                              
                                               BLH MIN     194     110                                                                                                                                                                                                                                                                                                              
                                               BLH MPR     194     110                                                                                                                                                                                                                                                                                                              
                                               BLH OVR     194     297                                                                                                                                                                                                                                                                                                              
                                               CDS MIN     194     110                                                                                                                                                                                                                                                                                                              
                                               ORF LNG     194      59                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 9e-007     NP_496323.1 mynd domain containing (48.5 kD) (2L84) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Sc ---- 1e-008     NP_015160.1 Set6p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 4e-013     BAE06699.1 SET and MYND domain containing protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 1e-013     AAH73650.1 MGC82991 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- ?? ---- 1e-013     NP_001085986.1 MGC82991 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 5e-034     NP_725048.1 CG7759-PA, isoform A [Drosophila melanogaster] ---=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 1e-073     XP_001181205.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 1e-128     NP_001070062.1 hypothetical protein LOC767654 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 4e-134     NP_795983.1 SET and MYND domain containing 4 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 2e-149     NP_001025886.1 SET and MYND domain containing 4 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 7e-166     NP_443160.1 SET and MYND domain containing 4 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xt ==== 0          AAI21315.1 Hypothetical protein MGC145614 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas125k11.3                                                                                                                                                                                                                                                                                                                            TAA---------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------ATG---------------------ATG------------------------------------------ATG---------------------------------------TAA---------------------------------ATG---------------------------------------------------------------------TAA------------------------------------------------TAG------------------------------TAA------------------------------------------TAG------------------------ATG------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Te4  FL                          CAAN7682.FL-MGC                                                                                                                                                                                                                                                                                                         GTGGGTTTTGAGACCAGCTTAATGTGGAAGAGATCAGTGTGGAGGGTACAAGAACGAACATTTGGTTCATTTCCCTACACTGAATGCGGATATAGTTAGAGCTGTCAACCGGACTTAAGCCAATTGCCTGACACCCCACCTCCCCCGTCAAACTGAATGGCTCTTCACAATCCCACTTCTACGGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTCAGAACATTGAGCAAGGGGAGGTCCTAATCTGGGAAGAAGCCTTTGCTAGTGTCATTATTCCAGAGAGAAAACAATGGAGAAAGGAAATAAAATGGGATACCAGAATTACAGCTTGTGATCATTACTGTCACTACTGCTTGAATAGAGTCATAGCTTCCCTGCCCTGTCAGTATTGCAGTTTTGCCAGATACTGTAGTCAGGAGTGTATGGATAAGGCCTGGAGAAGTTACCACTATATCGAGTGTTCAATGGGTGACCTGTTACTTGCTCTGGGGATGTTTTGCCACACAGCACTTAGGGCAGTTCTTGTAGCAGGCTGCAGGCTCTTTTCTCAGTCGTTAGAGCAGACTGGGTCTGCAGATGCCACTGATAAAACTAAAGTCTGCAATAGCAAAAGTACCTATCATGAAAAGTATTGCAGTTCCTACCAGTCTGTAGTCAATCTACTCCCGCACACTGAAAATCACCCGGCTGAGAGAAAGTTTCTCTGTGGACTCACTGCTGCAGCTTTGTACAAAAAACTGTGCTTGATAATGGCAAAGGATTTGGTGAGTTCCACATCACAGACAGAGAAATCCTTGACAAAAGAGTCCGGTACTATTGAAGACTGGTCCTCTGTGAGGCAATTCCTTGGTCCAACAGTACTCCGTCATATGCTGCAGCTCTATTGTAATGCACAAGCAGTGACAGCGCTCCAAGAGAATGAAGATGAGAGCAGTTTGTCGCTTGTGAAGAGCAACAAGAGCATTCGTCTTGCCACTGCAGTATTTCCTGTGCTGAGCCTGCTAAATCATTCCTGTGACCCCAATACCACTGTGTCATTTACGGGAAGGTTCGTTACGGTCAGAGCTAATAGGCCAATTAGGAGAGACGAGGAAGTGACACACTGCTATGGTCCCCACAAATTAAGAATGGATGTGGCTGAGAGGCAACAGTTACTGAAGGATCAATATTTTTTTGTGTGCCAGTGTAAAGCATGTACGGAGGAGTTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTCCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGATGTGAAAAAAAAAAAAAAAA
  0   1   1           Gas  FL                     TGas125k11.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTTATAAAGAAAGAAGCGCGCGTAAAGCGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTCAGAACATTGAGCAAGGGGAGGTCCTAATCTGGGAAGAAGCCTTTGCTAGTGTCATTATTCCAGAGAGAAAACAATGGAGAAAGGAAATAAAATGGGATACCAGAATTACAGCTTGTGATCATTACTGTCACTACTGCTTGAATAGAGTCATAGCTTCCCTGCCCTGTCAGTATTGCAGTTTTGCCAGATACTGTAGTCAGGAGTGTATGGATAAGGCCTGGAGAAGTTACCACTATATCGAGTGTTCAATGGGTGACCTGTTACTTGCTCTGGGGATGTTTTGCCACACAGCACTTAGGGCAGTTCTTGTAGCAGGCTGCAGGCTCTTTTCTCAGTCGTTAGAGCAGACTGGGTCTGCAGATGCCACTGATAAAACTAAAGTCTGCAATAGCAAAAATACCTATCATGAAAAGTATTGCAGTTCCTACCAGTCTGTAGTCAATCTACTCCCGCACACTGAAAATCACCCGGCTGAGAGAAAGTTTCTCTGTGGACTCACTGCTGCAGCTTTGTACAAAAAACTGTGCTTGATAATGGCAAAGGATTTGGTGAGTTCCACATCACAGACAGAGAAATCCTTGACAAAAGAGTCCGGTACTATTGAAGACTGGTCCTCTGTGAGGCAATTCCTTGGTCCAACAGTACTCCGTCATATGCTGCAGCTCTATTGTAATGCACAAGCAGTGACAGCGCTCCAAGAGAATGAAGATGAGAGCAGTTTGTCGCTTGTGAAGAGCAACAAGAGCATTCGTCTTGCCACTGCAGTATTTCCTGTGCTGAGCCTGCTAAATCATTCCTGTGACCCCAATACCACTGTGTCATTTACGGGAAGGTTCGTTACGGTCAGAGCTAATAGGCCAATTAGGAGAGACGAGGAAGTGACACACTGCTATGGTCCCCACAAATTAAGAATGGATGTGGCTGAGAGGCAACAGTTACTGAAGGATCAATATTTTTTTGTGTGCCAGTGTAAAGCATGTACGGAGGAGTTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGATGTGAAAAAAAAAAAAAAAAAA
  5   1   2       chi Te1                                 CBWN13415.b1 AACACTTGTTTGGCTATGATATGGCAAAACCCAGGCTAGTGATAGGTATAGAGCATGTGTTACATGCGACCTTAATACACAGGAGTGGGCCTCCGCTATATGGGAGGTAGTAATGGAGCTGAGGGTGTAGTTGAACTACAACTGAATAGAGCTTGTGTGGTGCAGATGGAATAATGGACGCCAGAAAGGTTCTTGCTCATGAACTATAGTACAATTTATTGGACAAAGGCACAACTTGGTGCAGCAGGGTATACTCACAGACACAGCAGTATAGAATGTGTGATCACCGTGGAAGATACAAGGGTGACACTTAGGCACAGAATAACCCACTTGGAGGATGCACAGAGGATTAGTTGACACCTGAGATATAGACCTTTCAGAAGGGAGTGTTCCGGCCGACTGTGGTCCAGGGGAGAGCTCCTAACACTGGTACCTGGCGTCTAATAAAACCGGTCCCTAAAGAACGACTACAGAGCCGGGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGGTC
  5  -1   1       add Egg                            TEgg117j15.p1kSP6                                                                          AAAATTTAAAACGAACGTCTCACTTTATGCTATTAAAAACAAATCCCGTATATTTCCTGCCAAAAAGGGCACAGTGACTGGCCTGCCAATAACAAGGATGGCGGCCAAGGTTCACAGTTTAGCGCAATATTATTGGCTGCCTGGGTGACGACATCGTGGCGCCAATACAATCCTGCAATGTTATAAAGAAAGAAGCGCGCGTAAAGCGGTGAGTGAGAGAGTTGTGGGTTTTGAGACCAGCTTAATGTGGAAGAGATCAGTGTGGAGGGTACAAGAACGAACATTTGGTTCATTTCCCTACACTGAATGCGGATATAGTTAGAGCTGTCAACCGGACTTAAGCCAATTGCCTGACACCCCACCTCCCCCGTCAAACTGAATGGCTCTTCACAATCCCACTTCTACGGGTAGACTATTACCATGAGTGTCTCAGGCCGCCTTCTTATTAGAAA
  5   1   2       bld Te4  FL   in                         CAAN7682.5p                                                                                                                                                                                                                                                                                                          TGGGTTTTGAGACCAGCTTAATGTGGAAGAGATCAGTGTGGAGGGTACAAGAACGAACATTTGGTTCATTTCCCTACACTGAATGCGGATATAGTTAGAGCTGTCAACCGGACTTAAGCCAATTGCCTGACACCCCACCTCCCCCGTCAAACTGAATGGCTCTTCACAATCCCACTTCTACGGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTC
  5   1   2   14 skin Te4  5g3  in                         CAAN5961.5p .....................................................................................................................................................................................................................................................................................................................CCAGCTTAATGTGGAAGAGATCAGTGTGGAGGGTACAAGAACGAACATTTGGTTCATTTCCCTACACTGAATGCGGATATAGTTAGAGCTGTCAACCGGACTTAAGCCAATTGCCTGACACCCCACCTCCCCCGTCAAACTGAATGGCTCTTCACAATCCCACTTCTACGGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTCAGAACATTGAGCAAGGGGAGGTCCTAATCTGG
  5   1   2       bld Gas  FL   in                   TGas125k11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTTATAAAGAAAGAAGCGCGCGTAAAGCGCCTTTCTTCTCCCTAATGGAACATCCAGTGCAAGAGTGGCAAGATCAAGCCCAAAGCATATGGGCACATCTTACCTCATCTGAGAAAGAGAAGTTTTCTTCTATTGCAGACCTTGATGAGATATTTCAGGCTTGTTTATCACATCTCCAACAGGATGAAGAGCAGCTTATAGAGAGACTTTGCTGCAATGTAACTGTGGCCAAAGACCCTAATGCAGTACAGTTCTTCAAAGAAGAAGGGAACAAGAGGTTTGCTGAAAAGCAGTATGCAACTGCAGCGGGTTTATATTCCAAGGCAATCTCCCATGCCAAATCTGGTTCTGAAGCATTGGCAGTATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAATGGGCGCTGGACAGGAATC
  5   1   2      skin Ovi1      in                          CABI907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCGATTCGATGCTTTGCAAACAGATCAGCAGCTCTGTTTTACCTTGGTCAGTATTCAGTATGCCTGGAGGATATTCAGCATGCACAAGACCATGGGTATCCTGAGCGACTAAGGAACAAAATTCTTCAGAGAAAGGCTGAATGCTTTCAGAGACTGAGAAAGCCATCCTCATGTGACCCCAAATTAGAATGTGTTGAGACTGTTAAGCCTAAAAAAGAGCCTCAAACGTCTACTGAAAGACTAAAAGAAATGGCGCTGGACAGGAATCCTCACATAACAAATGCCTCCTGTGCTTTGCACCTTAACTTTGACACTCGCAAAGGACGCCATTTATTGGCATCTCAGAACATTGAGCAAGGGGAGGTCCTAATCTGGGAAGAAGCCTTTGCTAGTGTCATTATTCCAGAGAGAAAACAATGGAGAAAGGAAATAAAATGGGATACCAGAATTACAGCTTGTGATCATTACTGTCACTACTGCTTGAATAGAGTCATAGCTTCCCTGCCCTGTCAGTATTGCAGTTTTGCCAGATACTGTAGTCAGGAGTGTATGGATAAGGCCTGGAGAAGTTACCACTATATCGAGTGTTCAATGGGTGACCTGTTACTTGCTCTGGGGATGTTTTGCCACACAGCACTTAGGGCAGTTCTTGTAGCAGGCTGCAGGCTCTTTTCTCAGTCGTTAGAGCAGACTGGGTCTGCAGATGCCACTGATAAAACTAAAGTCTGCAATAGCAAAAATACCTATCATGAAAAGTATTGCAGTTCCTACCAGTCTGTAGTCAATCTACTCCCGCACACTNGAAATCACCCGGCTGAGAGAAAGTTTCTCTGTGGACTCACTGCTGCAGCTTTGTACAAAAAACTGTGCTTGATAATGGCAAAGGATTTGGTGA
  5   1   2       bld Te5                                  CAAO2781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCAGACTGGGTCTGCAGATGCCACTGATAAAACTAAAGTCTGCAATAGCAAAAGTACCTATCATGAAAAGTATTGCAGTTCCTACCAGTCTGTAGTCAATCTACTCCCGCACACTGAAAATCACCCGGCTGAGAGAAAGTTTCTCTGTGGACTCACTGCTGCAGCTTTGTACAAAAAACTGTGCTTGATAATGGCAAAGGATTTGGTGAGTTCCACATCACAGACAGAGAAATCCTTGACAAAAGAGTCCGGTACTATTGAAGACTGGTCCTCTGTGAGGCAATTCCTTGGTCCAACAGTACTCCGTCATATGCTGCAGCTCTATTGTAATGCACAAGCAGTGACAGCGCTCCAAGAGAATGAAGATGAGAGCAGTTTGTCGCTTGTGAAGAGCAACAAGAGCATTCGTCTTGCCACTGCAGTATTTCCTGTGCTGAGCCTGCTAAATCATTCCTGTGACCCCAATACCACTGTGTCATTTACGGGAAGGTTCGTTACGGTCAGAGCTAATAGGCCAATTAGGAGAGACGAGGAAGTGACACACTGCTATGGTCCCCACAAATTAAGAATGGATGTGGCTGAGAGGCAACAGTTACTGAAGGATCAATATTTTTTTGTGTGCCAGTGTAAAGCATGTACGGAGGAGTTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAAACCTCAGGCTGAATCAGCTT
  3   1   2       bld Gas1                               IMAGE:6990938                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCCAATTTTGTAAACCGGCGGGGGAGGGGAGGTTTCTCGCATAAAGCGGGGGGTAAAAAAAAAAAAAAATCTTTCCCCTATGGGGGATTTTGTTTTTTCGCCGATTATCCCGGGTGTAGGGGGGCCAAAAGAGAGGCCCTCCCCAGGTTTTTTAGGAACCGGTATGCGTCACCGGGGCACGGGCACCCTTTTTTATTTACTGTTGGGGTACACCTGGGGGGTTGTCCCAAAAGGGCATGGGGTTAACCCTTTTATTTGGAGTGTGGGGGGCGGTTCAACCCCAAGGCATCTCCCCCAGGGGTTTTAAAACCCCTTTTCCAAAGGGGGGGCTCGTGGGAAATATTCCCAGGGGCTTTTGGGGGGGGAAAATCCCCCCATTAAATTTTGCACAAATATTTAGGGGTTTTAAAAACGGGTTTAACCCAGGGGCTTTTGGGCCACGGGGGCCCCCCATGCCCACAAGGGGACCAACGGGATTTAATATTTGCCTTAAAGAAAATGGAACGTTTTGAAATTGTTCCCTGTTTTTATTCCAGGAAAGGCGGAGGTGTTTTTCCTCTTCCCCAGGGATCCACCTGGGTTGTTTGGGGGAGATTCCAGGGATCATCCTGGCTTCAGGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGTTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATCTATGATACGCATTTCCGCGAAACTNCCGGGGGGGGGGCCGGCTGGGNTGGCCGGCGGGGGCGCCGGGCGCGGGGCGCGGGGGGGGTCGGGCGCGCGGGGGCGCGCGTGGGTCGGCCGGGGTCGGGCGGCCCGTGCGCGGGGCCGGTCGGCGCGCGGGTCGTGCGGGGCGCGCGGCGTCGTGGGGGTGGGGGGTG
  5   1   2       bld Tad0                               IMAGE:6981722                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGTGACACACTGCTATGGTCCCCACAAATTAAGAATGGATGTGGCTGAGAGGCAACAGTTACTGAAGGATCAATATTTTTTTGTGTGCCAGTGTAAAGCATGTACGGAGGAGTTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAAACTAGTTTCTGTTTATAAGTTATTCCTCCCGGCCTTTTGCATCCTGTTGCATTAGTGGCTCGGGGACCTCCCCATAACAGTCCCCGAATAAATGGTATCTGGTGTTCCCAACCTGCCTGGGGGGGACCTAAA
  3   1   2      seed Gas  FL   in                    TGas125k11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGTGCCAGTGTAAAGCATGTACGGAGGAGTGAAAGGGAAAAAAACTCATGGATTTTTCTGTCCGCTGTGCAAAGCCCAGTTAGAGGGTGAGGAGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGATGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4  FL   in                         CAAN7682.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAGGGCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTCCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGATGTG
  3   1   2       bld Ovi1      in                          CABI907.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCATTATACTGTACTGGTGCAAGATGTACTTATACTGCGTCACAGACCCAGTTAACCTCAAGGCTGAATCAGCTTGGGAACCATATTCAAATAGCTAAGGTACAGCTGCAGGACAACAAGACAGATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGTAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGATGG
  3   1   2       bld Te4  5g3  in                         CAAN5961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTAGTCACAGCCAAATATTACAAATAATGCTAAAATGACGTTGATGTCCTGTTTATCAGAAGCGGAGTGTTTTCTCTCCCAGGATCACCTGCTGTTGGGGGAGATCATGGATCATCTGGCTCAGGCTGAAGCTTCTGATGGCAATTGGAAAGCAGCTGCAGGACATCTTAGAAAGAGCATCAGCATAGTTAAAGTCCATTATGGCTCCTCCAGTATGGAACTTGGACATGAACTCTTTAAGCTGGCTCAGATCCTATTTAATGGGTTTGAGGTGCCTGATGCAATGAGAACTATCATGGAGGCTCAGAAAGTTCTGTCGATGCACTATGGACCTGATCACAATCTAGTGCAAGAGTTGAAAACTATGGAGGAATGTCTGTTACAGTTCCATGGTTATCCTAGAAAGTAACTAACGTTCCCTTCTCAAACCAAGAGGAATGATATGGAAGAACGTAAGAGGAGGACCTGTTACTGTAAATCAGAGTTTATAGTAGATGCCATAATATTATTTGCTTAACTAGTTTCTGTTTATAAGTTATCCTCCAGCCTTTTGCATCTGTTGCATTAGTGCTCGGGAACTCCCATAACAGTCACAGAGTAATGTATCTGTGTTCCAACTGCTGGGGGACTAAGTCTAACTAATTAGAAGCTTGCTCATTGCACTTTATTTATGATATGCATGTCCCTGTTCTGTCATTATTTTAATAAATATCACAGATGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)