Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Sep 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 886.0    0Xt7.1-TGas022a06.5.5                      133 PI      98          1      484                histone 2, H2bf [Xenopus tropicalis]
     2 600.0    0Xt7.1-TNeu063l06.5.5                       15 PI      90         25      465                histone 1, H2bk [Xenopus tropicalis]
     31059.0    0Xt7.1-TNeu105d22.3                          2 PI      98          2      584                histone 2, H2bf [Xenopus tropicalis]
     4 678.0    0Xt7.1-TNeu080l09.3                          2 PI      97        105      491                Histone 1, H2bk [Xenopus tropicalis]
     5 351.0    0Xt7.1-IMAGE:7020799.5                       2 PI      95        275      486                Histone 1, H2bk [Xenopus tropicalis]
     6 796.0    0Xt7.1-st61o01.5                             2 PI      94          5      491                histone 2, H2bf [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012085718 Xt7.1-st3p03.3 - 8 ESTs
                                                                       .-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                        Xt7.1-st3p03.3                      CGGAAAGCGTAAGGATAGTTGATCATGCCTGAACCAGCCAAATCCACTCCAGCCGCGAAGAAAGGCTCCAAGAAAGCGGTGACCAAGACCCAGAAGAAAGATGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGGGCCCCCACTCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATACTCGTACGACTCAGGCCTCGGTGGCGCCGCCCTGGGCTGTAGTTATTCCCGTCTCTCCTTGCAGTAATGCCCGGCACTCTGTAGTCTCTTGTTATTTCTATGGTTTGATGGTTCTTTCTCTCTATAATTCTGTATGTGGGGCTGAGTTAGAATGAGCCAGGACTGGCAGCTCTGGAGGCCCCACCACTTGGGGAGCTGCAAAAGGATTAGTCTGGGCCGCTGGGGTTGGATGGCTCATTCTGACCATGGTAGAAGTGAAGAGATAACATGGCGCTAGTGATGA
                                                  Xt7.1-CHK-1008237990                            GCGTAAGGATAGTTGATCATGCCTGAACCAGCCAAATCCACTCCAGCCGCGAAGAAAGGCTCCAAGAAAGCGGTGACCAAGACCCAGAAGAAAGATGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGGGCCCCCACTCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATACTCGTACGACTCAGGCCTCGGTGGCGCCGCCCTGGGCTGTAGTTATTCCCGTCTCTCCTTGCAGTAATGCCCGGCACTCTGTAGTCTCTTGTTATTTCTATGGTTTGATGGTTCTTTCTCTCTATAATTCTGTATGTGGGGCTGAGTTAGAATGAGCCAGGACTGGCAGCTCTGGAGGCCCCACCACTTGGGGAGCTGCAAAAGGATTAGTCTGGGCCGCTGGGGTTGGATGGCTCATTCTGACCATGGTAGAAGTGAAGAGATAACATGGCGCTAGTGATGAGTGAAA
                                                      consensus depths                           3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     4     8     4     8     4     6     4     6     4     6     4     6     4     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2
                                               BLH ATG      24     604                      
                                               BLH MIN      24      71                      
                                               BLH OVR      24    1198                      
                                               ORF LNG      24      12                      
                                                                                                     PROTEIN --- Sc ---- 3e-044     NP_010510.1 Histone H2B (HTB1 and HTB2 code for nearly identical proteins); Htb1p[Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN === Dm ==== 3e-049     NP_724342.1 His2B:CG17949 CG17949-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN === Sp ==== 5e-051     NP_999717.1 late histone L1 H2b [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ce ---- 2e-051     NP_507031.1 histone (his-4) [Caenorhabditis elegans] ===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === Mm ==== 7e-061     NP_835503.1 histone 1, H2bg [Mus musculus] ================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === Gg ==== 2e-061     NP_001026652.1 histone H2B [Gallus gallus] ================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === Hs ==== 2e-061     NP_066402.2 H2B histone family, member R [Homo sapiens] ===================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === Dr ==== 1e-061     NP_956411.1 Unknown (protein for MGC:73093); wu:fj05g08 [Danio rerio] =====================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === ?? ==== 1e-063     NP_001086753.1 histone H2B [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === Xl ==== 4e-064     1F66 Chain D, 2.6 A Crystal Structure Of A Nucleosome Core Particle Containing TheVariant Histone H2a.Z [Xenopus laevis]  =================================================================================================================================================================================================================================
                                                                                                                    PROTEIN === Xt ==== 2e-064     CAJ82556.1 histone 2, H2bf [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================
                                                        Xt7.1-st3p03.3                               TAA---TAG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------TAG------------------------TAG---------------------------------------------------------------------------TAA---------------------------------------------------------TAA------ATG------TGA------ATG---------------------------------------------------------------------------ATG------------------------------------------TAGTGATGA
                                                                   ORF                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                     ]
  3   1   2       bld Gas8 5g3  in                         st102i10.3p                      CGGAAAGCGTAAGGATAGTTGATCATGCCTGAACCAGCCAAATCCACTCCAGCCGCGAAGAAAGGCTCCAAGAAAGCGGTGACCAAGACCCAGAAGAAAGATGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTGTAAGAGCCACTCACCCCCTCCCTATAAGAT
  5   1   2       bld Gas8 5g3  in                         st103i10.5p                      CCGGAAGCGTAAGGATAGTTGATCATGCCTGAACCAGCCAAATCCACTCCAGCCGCGAAGAAAGGCTCCAAGAAAGCGGTGACCAAGACCCAGAAGAAAGATGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGAGCCACTCACCCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATAAAAAAAAAA
  3   1   2       bld Gas8 5g3  in                         st103i10.3p                      CGGAAAGCGTAAGGATAGTTGATCATGCCTGAACCAGCCAAATCCACTCCAGCCGCGAAGAAAGGCTCCAAGAAAGCGGTGACCAAGACCCAGAAGAAAGATGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGAGCCACTCACCCCCTCCCTATAAGATCTG
  5   1   2      skin Gas8 5g3  in                         st102i10.5p                                 AGGATAGTTGATCATGCCTGAACCAGCCAAATCCACTCCAGCCGCGAAGAAAGGCTCCAAGAAAGCGGTGACCAAGACCCAGAAGAAAGATGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGAGCCACTCACCCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATAAAAAAAAAA
  3   1   2       bld Gas8      in                           st4p03.3p                                                                                                         AAGACCCAGAAGAAAAGACNGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGGGCCCCCACTCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATACTCGTACGACTCAGGCCTCGGTGGCGCCGCCCTGGGCTGTAGTTATTCCCGTCTCTCCTTGCAGTAATGCCCGGCACTCTGTAGTCTCTTGTTATTTCTATGGTTTGATGGTTCTTTCTCTCTATAATTCTGTATGTGGGGCTGAGTTAGAATGAGCCAGGACTGGCAGCTCTGGAGGCCCCACCACTTGGGGAGCTGCAAAAGGATTAGTCTGGGCCGCTGGGGTTGGATGGCTCATTCTGACCATGGTAGAAGTGAAGAGATAACATGGCGCTAGTGATGAGTGAAATC
  5   1   2       bld Gas8      in                           st4p03.5p                                                                                                                          ACGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGGGCCCCCACTCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATACTCGTACGACTCAGGCCTCGGTGGCGCCGCCCTGGGCTGTAGTTATTCCCGTCTCTCCTTGCAGTAATGCCCGGCACTCTGTAGTCTCTTGTTATTTCTATGGTTTGATGGTTCTTTCTCTCTATAATTCTGTATGTGGGGCTGAGTTAGAATGAGCCAGGACTGGCAGCTCTGGAGGCCCCACCACTTGGGGAGCTGCAAAAGGATTAGTCTGGGCCGCTGGGGTTGGATGGCTCATTCTGACCATGGTAG
  5   1   2       bld Gas8      in                           st3p03.5p                                                                                                                           CGGGAAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGGGCCCCCACTCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATACTCGTACGACTCAGGCCTCGGTGGCGCCGCCCTGGGCTGTAGTTATTCCCGTCTCTCCTTGCAGTAATGCCCGGCACTCTGTAGTCTCTTGTTATTTCTATGGTTTGATGGTTCTTTCTCTCTATAATTCTGTATGTGGGGCTGAGTTAGAATGAGCCAGGACTGGCAGCTCTGGAGGCCCCACCACTTGGGGAGCTGCAA
  3   1   2      seed Gas8      in                           st3p03.3p                                                                                                                               AAGAAGCGCAGGAAGACAAGGAAGGAGAGTTACGCCATTTACGTGTACAAGGTGCTGAAGCAGGTGCACCCCGATACCGGCATCTCCTCCAAGGCCATGAGCATCATGAACTCCTTTGTCAACGATGTGTTTGAGCGCATCGCAGGGGAAGCCTCCCGCCTGGCTCATTACAACAAGCGCTCCACCATCACCTCCCGGGAGATCCAGACCGCGGTCCGCCTGCTGCTGCCTGGGGAGCTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCTGTCACCAAGTACACCAGCGCCAAGTAACTGCTGCCCCATCTCCTGCCCTACTCCCGGCAACACAAAGGCTCTTCTAAGGGCCCCCACTCCCTCCCTATAAGATCTGTAACTGGTTAGTATAAAGGCGCCGCACTATCTGTATAGGGAACACAATACTCGTACGACTCAGGCCTCGGTGGCGCCGCCCTGGGCTGTAGTTATTCCCGTCTCTCCTTGCAGTAATGCCCGGCACTCTGTAGTCTCTTGTTATTTCTATGGTTTGATGGTTCTTTCTCTCTATAATTCTGTATGTGGGGCTGAGTTAGAATGAGCCAGGACTGGCAGCTCTGGAGGCCCCACCACTTGGGGAGCTGCAAAAGGATTAGTCTGGGCCGCTGGGGTTGGATGGCTCATTCTGACCATGGTAGAAGTGAAGAGATAACATGGCGCTAGTGATGAGTGAAATCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)