Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ13295.5                           2 END     2          22      100                Glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012085746 Xt7.1-CABK930.3 - 9 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     4     4     4     4     4     4     5     5     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                       ...PROTEIN --- Sc ---- 2e-009     NP_012107.1 Bni1p-related protein, helps regulate reorganization of the actin cytoskeleton,potential target of Rho4p; Bnr1p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Ce ---- 1e-014     NP_503132.2 predicted CDS, actin-binding FH2 (5A542) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 4e-021     AAH82512.1 Fmnl1-prov protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-021     AAH73482.1 LOC443650 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - ?? ---- 8e-023     XP_688579.1 PREDICTED: similar to Disheveled associated activator of morphogenesis 1 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-026     NP_476981.1 diaphanous CG1768-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 1e-028     XP_001175501.1 PREDICTED: similar to glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Hs ---- 8e-080     XP_940765.1 PREDICTED: similar to glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 isoform 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 8e-083     NP_579933.1 glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-085     NP_001038368.1 hypothetical protein LOC559717 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 2e-088     XP_425245.2 PREDICTED: similar to L-delphilin [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CABK930.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---TAA------------------------------------------------------------------------------------------------------------------------TAA---------------------------TGA------------------------------------------------------------------------------TAG---TAA---------------------------------------------------TAA---------TAG---------------------------------------------------------------------------TAA---------------------------------------------TAA---------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Spl1      in                          CABK930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGGGACATCCATCTACATGCCTCTTCCTGATAGACGTTAGGAATACCCCATTGCTGAACCCAGGCAGCGCTGTATTCATGGGATGCATGCAGATCTCTGGAGTGCAACGACCTGCGACAGTTCATTGATCTCTATGGCATGGAGCAAAGTGCAAAAAGCATGGAAGATTAACCCTGTTTTTTTGCACCATACCTTGCCAATAGCAAATGACCTTGATTTGTTGCCAGTTTGTTTTAGCTATGGGGAACTATCTGAATGACGGACAGCCCAAAACCAACAGAACAACTGGATTCAAGATCAATTTCCTTACAGAGCTAAACACCACCAAGACAGTAGATGGAAAATTCACCTTCCTGCACATTCTCGCCAAATCCCTCAGCCAGCATTTCCCCGAGCTGCTGAGCTTTGCCAAGGATCTCCCTACTGTGCCTCTCGCTGCCAAAGTTAATCAGAGGTCTGTAACGGCTGATCTGAGCGACCTCCACGTAACTATTCAGGAGATAAAAAGTGTCTGCAGCCGGATGCCCAGCTCCCAAGAAGACATGTTCTCTCTTACCATGAGTACCTTTCTAGAGAACTCCTTCCCTTGTATGCAAACACTGGACACATTGCAGCACAGGGCATTAGAAGATTTCTTTAAAGTGTGCTTATACTTTGGAGAAGACCCAAAGACCACCACCACAGAAGCTTTCTTTGGAATCTTTGCAGAGTTCAAGAGCAAGTTTGAGAAAGCCTTTAATGACCTTCAGGCTGGTGAGCCTCAGTTGCTCCAAGGGAATTCTTGCACACCGATGTGGTAACAACGCTGCCCCTTATGGCT
  5   1   2       bld Brn4      in                         CAAL7916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCAAGAGCACCCTGCAGGAGAAGACGGAGGAGATCAGAGCCAGCTGCGACTGCATCCTAAAAGCCTCTTCAGAGCTCAAAAACAGCAAGAAACTGGCCAAGATTTTGGAGTTTGTTTTAGCTATGGGGAACTATCTGAATGACGGACAGCCCAAAACCAACAGAACAACTGGATTCAAGATCAATTTCCTTACCGAGCTAAACACCACCAAGACAGTAGATGGAAAATTCACCTTCCTGCACATTCTCGCCAAATCCCTCAGCCAGCATTTCCCCGAGCTGCTGAGCTTTGCCAAGGATCTCCCTACTGTGCCTCTCGCTGCCAAAGTTAATCAGAGGTCTGTAACGGCTGATCTGAGCGACCTCCATGTAACTATTCAGGAGATAAAAAGTGTCTGCAGCCGGATGCCCAGCTCCCAAGAAGACATGTTCTCTCTTACCATGAGTACCTTTCTAGAGAACTCCTTCCCTTGTATGCAAACACTGGACACATTGCAGCACAGGGCATTAGAAGATTTCTTTAAAGTGTGCTTATACTTTGGAGAAGACCCTAAGACCACCACCACAGAAGCTTTCTTTGGAATCTTTGCAGAGTTCAAGAGCAAGTTTGAGAAAGCCTTTAATGACCTTCAGGCTGGTGAGCCTCAGTTGCTCCAAGGGAATTCTTGCACACCGATGTGGTAACAACGCTGCCCCTTATGGCTGAATTATAATCCTTTGAATTCTCCTGTCCTGGTTCATCAACAGCTGCCCCTAANAAACTGCCTGACATTAGCACCGGGAAGATCAAAGGCCGTCAGGAAGTAATGG
  3   1   2       bld Te4       out                        CAAN3617.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGATCTTTGCAGAGTTCAGAGCAAGTTTTGAGAAAGCCTTTAATGACCTTCAGGCTGGTGAGCCTCAGTTGCTCCAGGGGAATTCTTGCACACCGATGTGGTAACAACGCTGCCCCTTATGGCTGAATTATAATCCTTTGAATCCTCCTGTCCTGGTTCATCAACAGCTGCCCCTAAAAAAATGCCTGACATTAGCACCGGGAAGATCAAAGGCCGTCAGGAAGTAATGGAGAAGAACTGGTTGTAGATGGAAATGAGACATTCCAAACCCAGTAGCTGGCAAATGTTCTGTAACCCCCTTCAGTGCCAGAGATACTTGCCATGCGTGTTTGTTTTAGCAATAAGTCCTTGTTAATCTAGAAGACACAGCGGTGGAAAGCAAGACAAGAAACTCATAAGACATTGTATAGATCAGTGCTGTACAAGTTTTCCCATGCCTTGGGCCAGTTATCTTCTATTTCGCATGTTTGGGGGCCAGAATATTATAAAACAATGATGTCATCTATGGAGATCTTGGGCATGTGGGGGGCCATTAAAATATTTTGGAGGACTTTATCTGTCCATGGGCCTCCAGTCGGACAAAAGGCTATTTAAGTCCAATGATGAAAAGTGGGAATTGGTCTGTTCATCTGAATTCCGCTTATCTCCGCTTTAGTCCCACTACTCTGTTTGCACAGCCATCACACTGCTGTTCCGCGGATGTGGCAGTGGTCTGTACAGTAGATAGAGCTGTGCAGCCGTTGGTAACATGATCAAGAAGGAAAATCTTGAGATGGGATTTTACACTGGAAACAAATATTTATTGTTTTTATTTATTTTGCAGATGTAAATCACTGCAATAAAGAGACAAGTATTTAATAC
  3   1   2       bld Spl1      in                          CABK930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATCTTTGCAGAGTTCAAGAGCAAGTTTGAGAAAGCCTTTAATGACCTTCAGGCTGGTGAGCTTCAGTTGCTCCAAGGGAATTCTTGCACACCGATGTGGTAACAACGCTGCCCCTTATGGCTGAATTATAATCCTTTGAATCCTCCTGTCCTGGTTCATCAACAGCTGCCCCTAAAAAACTGCCTGACATTAGCACCGGGAAGATCAAAGGCCGTCAGGAAGTAATGGAGAAGAACTGGTTGTAGATGGAAATGAGACATTCCAAACCCAGTAGCTGGCAAATGTTCTGTAACCCCCTTCAGTGCCAGAGATACTTGCCATGCGTGTTTGTTTTAGCAATAAGTCCTTGTTAATCTAGAAGACACAGCGGTGGAAAGCAAGACAAGAAACTCATAAGACATTGTATAGATCAGTGCTGTACAAGTTTTCCCATGCCTTGGGCCAGTTATCTTCTATTTCGCATGTTTGGGGGCCAGAATATTATAAAACAATGATGTCATCTATGGAGATCTTGGGCATGTGGGGGGCCATTAAAATATTTTGGAGGACTTTATCTGTCCATGGGCCTCCAGTCGGACAAAAGGCTATTTAAGTCCAATGATGAAAAGTGGGAATTGGTCTGTTCATCTGAATTCCGCTTATCTCCGCTTTAGTCCCACTACTCTGTTTGCACAGCCATCACACTGCTGTTCCGCGGATGTGGCAGTGGTCTGTACAGTAGATAGAGCTGTGCAGCCGTTGGTAACATGATCAAGAAGGAAAATATTGAGATGGGATTTTACACTGGAAACAAATATTTATTGTTTTTATTTATTTTGCAGATGTAAATCACTGCAATAAAGAGACAAGTATTTAATAC
  3   1   2       bld Te4  5g3  out                        CAAN2799.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGCTTCAGTTGCTCCAAGGGAATTCTTGCACACCGATGTGGTAACAACGCTGCNCCTTATGGCTGAATTATAATCCTTTGAATCCTCCTGTCCTGGTTCATCAACAGCTGCCCCTAAAAAAATGCCTGACATTAGCACCGGGAAGATCAAAGGCCGTCAGGAAGTAATGGAGAAGAACTGGTTGTAGATGGAAATGAGACATTCCAAACCCAGTAGCTGGCAAATGTTCTGTAACCCCCTTCAGTGCCAGAGATACTTGCCATGCGTGTTTGTTTTAGCAATAAGTCCTTGTTAATCTAGAAGACACAGCGGTGGAAAGCAAGACAAGAAACTCATAAGACATTGTATAGATCAGTGCTGTACAAGTTTTCCCATGCCTTGGGCCAGTTATCTTCTATTTCGCATGTTTGGGGGCCAGAATATTATAAAACAATGATGTCATCTATGGAGATCTTGGGCATGTGGGGGGCCATTAAAATATTTTGGAGGACTTTATCTGTCCATGGGCCTCCAGTCGGACAAAAGGCTATTTAAGTCCAATGATGAAAAGTGGGAATTGGTCTGTTCATCTGAATTCCGCTTATCTCCGCTTTAGTCCCACTACTCTGTTTGCACAGCCATCACACTGCTGTTCCGCGGATGTGGCAGTGGTCTGTACAGTAGATAGAGCTGTGCAGCCGTTGGTAACATGATCAAGAAGGAAAATATTGAGATGGGATTTTACACTGGAAACAAATATTTATTGTTTTTATTTATTTTGCAGATGTAAATCACTGCAATAAAGAGACAAGTATTTAATAC
  3   1   2       bld Brn4      in                         CAAL7916.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCCTCAGTTGCTCCAAGGGAATTCTTGCACACCGATGTGGTAACAACGCTGCCCCTTATGGCTGAATTATAATCCTTTGAATTCTCCTGTCCTGGTTCATCAACAGCTGCCCCTAAAAAACTGCCTGACATTAGCACCGGGAAGATCAAAGGCCGTCAGGAAGTAATGGAGAAGAACTGGTTGTAGATGGAAATGAGACATTCCAAACCCAGTAGCTGGCAAATGTTCTGTAACCCCCTTCAGTGCCAGAGATACTTGCCATCCGTGTTTGTTTTAGCAATAAGTCCTTGTTAATCTACAAGACACAGCGGTGGAAAGCAAGACAAGAAACTCATAAGACATTGTATAGATCAGTGCTGTACAAGTTTTCCCATGCCTTGGGCCAGTTATCTTCTATTTCGCATGTTTGGGGGCCAGAATATTATAAAACAATGATGTCATCTATGGAGATCTTGGGCATGTGGGGGGCCATTAAAATATTTTGGAGGACTTTATCTGTCCATGGGCCTCCAGTCGGACAAAAGGCTATTTAAGTCCAATGATGAAAAGTGGGAATTGGTCTGTTCATCTGAATTCCGCTTATCTCTGCTCTAGTCCCACTACTCTGTTTGCACAGCCATCACACTGCTGTTCCGCGGATGTGGCAGTGGTCTGTACAGTAGATAGAGCTGTGCAGCCGTTGGTAACATGATCAAGTAGGAAAATATTGAGATGGGATTTTACACTGGAAACAAATATTTATTGTTTTTATTTATTTTGCAGATGTAAATCACTGCAATAAAGAGACAAGTATTTAATAC
  3   1   2      seed Brn2 FL   out                       CAAJ13295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCACACCGATGTGGTAACAACGCTGCCCCTTATGGCTGAATTATAATCCTTTGAATCCTCCTGTCCTGGTTCATCAACAGCTGCCCCTAAAAAAATGCCTGACATTAGCACCGGGAAGATCAAAGGCCGTCAGGAAGTAATGGAGAAGAACTGGTTGTAGATGGAAATGAGACATTCCAAACCCAGTAGCTGGCAAATGTTCTGTAACCCCCTTCAGTGCCAGAGATACTTGCCATGCGTGTTTGTTTTAGCAATAAGTCCTTGTTAATCTAGAAGACACAGCGGTGGAAAGCAAGACAAGAAACTCATAAGACATTGTATAGATCAGTGCTGTACAAGTTTTCCCATGCCTTGGGCCAGTTATCTTCTATTTCGCATGTTTGGGGGCCAGAATATTATAAAACAATGATGTCATCTATGGAGATCTTGGGCATGTGGGGGGCCATTAAAATATTTTGGAGGACTTTATCTGTCCATGGGCCTCCAGTCGGACAAAAGGCTATTTAAGTCCAATGATGAAAAGTGGGAATTGGTCTGTTCATCTGAATTCCGCTTATCTCCGCTTTAGTCCCACTACTCTGTTTGCACAGCCATCACACTGCTGTTCCGCGGATGTGGCAGTGGTCTGTACAGTAGATAGAGCTGTGCAGCCGTTGGTAACATGATCAAGAAGGAAAATATTGAGATGGGATTTTACACTGGAAACAAATATTTATTGTTTTTATTTATTTTGCAGATGTAAATCACTGCAATAAAGAGACAAGTATTTAATACAAATAGAACTATTT
  3   1   2       bld Eye       in                         CCAX3063.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATAAAGTCCTTGTTAATCTACAAGACACAGCGGGTGGAAAAGCAAGACAAGAAACTCATAAGACATTGTATAGATCAGTGCTGTACAAGTTTTCCCATGCCTTGGGCCAGTTATCTTCTATTTCGCATGTTTGGGGGCCAGAATATTATAAAACAATGATGTCATCTATGGAGATCTTGGGCATGTGGGGGGCCATTAAAATATTTTGGAGGACTTTATCTGTCCATGGGCCTCCAGTCGGACAAAAGGCTATTTAAGTCCAATGATGAAAAGTGGGAATTGGTCTGTTCATCTGAATTCCGCTTATCTCCGCTTTAGTCCCACTACTCTGTTTGCACAGCCATCACACTGCTGTTCCGCGGATGTGGCAGTGGTCTGTACAGTAGATAGAGCTGTGCAGCCGTTGGTAACATGATCAAGAAGGAAAATATTGAGATGGGATTTTACACTGGAAACAAATATTTATTGTTTTTATTTATTTTGCAGATGTAAATCACTGCAATAAAGAGACAAGTATTTAATCC

In case of problems mail me! (