Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK2536.3.5                         32 END     3          60        9                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012085818 Xt7.1-CAAM2231.5 - 5 ESTs
                                                                       ..-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM2231.5                                                                                                       GCCCCGCTAGGAACCATGTCTGCCTTGGAAAAGCAGCTGCAACTGGGACGCTTACCACCACGACCCACAATGCCTGGGGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCGAGTTTCAATGGCTGGCCAGATCAAACAGTGTGAAGAGGCA
                                                  Xt7.1-CHK-1008243364                                                                                                             GxxxGAACCATGTCTGCCTTGGAAAAGCAGCTGCAACTGGGACGCTTACCACCACGACCCACAATGCCTGGGGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCGAGTTTCAATGGCTGGCCAGATCAAACAGTGTGAAGAGGCATCAACT
                                                      consensus depths                                                                                                            2     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4
                                               BLH ATG      15     664                                                                                                       
                                               BLH MIN      15      95                                                                                                       
                                               BLH OVR      15     168                                                                                                       
                                               ORF LNG      15       9                                                                                                       
                                                                       PROTEIN --- Sc ---- 4e-018     NP_011942.1 Ppe1p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PREDICTED - Ce ---- 5e-053     NP_499084.1 predicted CDS, protein phosphatase (3K555) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN === Dm ==== 1e-066     NP_648277.3 CG5068-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 6e-075     XP_001202410.1 PREDICTED: similar to Protein phosphatase methylesterase 1, partial [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN === Dr ==== 1e-106     NP_956231.1 Similar to RIKEN cDNA 2700017M01 gene [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN === Gg ==== 3e-109     NP_001026005.1 protein phosphatase methylesterase-1 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN === Mm ==== 2e-119     NP_082568.1 protein phosphatase methylesterase 1 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN === Hs ==== 2e-119     NP_057231.1 protein phosphatase methylesterase-1 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN === Xl ==== 8e-130     AAH77600.1 MGC84506 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PROTEIN === ?? ==== 8e-130     NP_001086882.1 MGC84506 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM2231.5                                                                                                                TGA---ATG---------------------------------------------------ATG---------------------------ATG---ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   2   14  bld Te3  5g3  out                        CAAM6951.5p ...................................................................GCTGAGTGGGTGGGTCCGACTGTCACCACGGAAACCCCTTTGGCTGAACCATGTCTGCCTTGGAAAAGCAGCTGCAACTGGGACGCTTACCACCACGACCCACAATGCCTGGGGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCG
  5   1   2       bld Te5       in                        CAAO12425.5p                                                                                           TCCTAAGGGGAGGCCCCGCTAGGAACCATGTCTGCCTTGGAAAAGCAGCTGCAACTGGGACGCTTACCACCACGACCCACAATGCCTGGGGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCGAGTTTCAATGGCTGGCCAGATCAAACAGTGTGAAGAGGCATNCACTCCCGA
  5   1   2   14 seed Te3  PIPE out                        CAAM2231.5p ...............................................................................................AGGGGAGGCCCCGCTAGGAACCATGTCTGCCTTGGAAAAGCAGCTGCAACTGGGACGCTTACCACCACGACCCACAATGCCTGGGGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCGAGTTTCAATGGCTGGCCAGATCAAACAGTGTGAAGAGGCATCAACT
  5   1   2   14  bld Te3  5g3  out                        CAAM2855.5p ........................................................................................................CTTTGGCTGAACCATGTCTGCCTTGGAAAAGCAGCTGCAACTGGGACGCTTACCACCACGACCCACAATGCCTGGGGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCGAGTTTCAATGGCTGGCCAGATCAAACAGTGTGAAGAGGCATCAACTCCCGA
  3   1   2       bld Te5       in                        CAAO12425.3p                                                                                                                                                                                    GGGGCTTCAGTCTGGATCTAAAATGAGAATGGGGCCGGGCAGGAGGCGGGACTTCTCCCCTGTACCTTGGAGCCAGTACTTTGAATCCATGGAAGATGTCGTGGTGGAAAGCGAGACGGGCAAAGACAGCTTTCGCGTTTACAGAAGTGGCTCTGAGGGGCCAGTGTTGCTTCTACTACATGGGGGTGGTCACTCTGCACTTTCCTGGGCAGTGTTTACTACTGCAATAACCAGCAGAATACGCTGCAGGGTGGTGGCGCTGGATCAGAGGGGCCACGGTGAAACGAAAGTGAAGAATCCAGAGGATCTCTCCGCAGAGACAATGGCCAGGGACATCGGGAATGTCGTGGAAGCCTTATACGGAGACTTGCCTCCTCCCATCATGCTTATTGGCCACAGTATGGGCGGAGCTATCGCCGTTCATACAGCAGCTGCAAACCTGGTGCCCAGCTTATTGGGCCTGTGCGTGATTGATGTCGTTGAAGGCACCGCCATGGACGCACTCAACAGTATGCAGAACTTCTTAAGGAGCCGCCCGAAAACTTTCAAATCTTTGGAGAATGCCATAGAATGGAGTGTGAAAAGTGGTCAGATCAGGAACCTGGAATCTGCCCGAGTTTCAATGGCTGGCCAGATCAAACAGTGTGAAGAGGCATCAACTCCCGAGGGGCCCAAAGCTATAGTAGAAGGCATCATTGAAGAAGAAGAAGAAGAGGAGGATGAGGAGGAAAATGGTGGCCAGTCCATCAATAAGAGGAAGAAGGAAGATGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)