Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG59918.3.5                         27 END     1           9        3                DNA topoisomerase I; type I DNA topoisomerase [Homo sapiens]

 This cluster: approximate FL confidence score = 89%

 1012085936 Xt7.1-CAAM9354.5 - 11 ESTs
                                                                       .....-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM9354.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAATATACAGGAACAAAAAGGGGGGTTGCCATGCAAAACTGAAAAGGAAAGAGACGGCCATCACAAATCCAAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTCAGAGAAAAAGGAAAAGGGGGATTCAGAGAAAAAGGAAAGGGGGAAAAACCATTTGTGTAGAGATTCAGAGGGGGGGAAAGAAAGTTTAAAAAGGGGCAAAGAAAACAAAGAGTCTAAAAGCGAGCAGAAAGCCATTGATGGGACTGAAGGCATCACCCAGCCAGAAAGAGAGAAGAAATGTGAAGATAAAATGGCATCAGGGAAAGAGAGAGAATCTGCCGAGGAGAAGGAAACTGGTAAGAGAGACCCCCTGAAATCCAAAGATAAAACATCTGCTGGGGAGGAAAGAAAGCCAAAAAAGCATTCTCACAAAGAGAAGTCCAAAGAGATGAACAGAACAAGAGAGAAGATGGAAGATGCTAAGATGTCAGTGTCTCGTGACCATCACAGGAAAGGAGATGCCCTGGAGGGGGCAGTGGAAGCCAACGAGGCAGTAAAACCTGAAAGAATTGAGGTGGCTGTTGGGGAACCCAAGGAACACAGCAGGGAAGTAGATGAGAAGGTCCATCTCAGGGTAAAGAGCTTCGAGGAGGAGCTGAATGAGTTGGCCAACCTGAAAATGCAGAGCAGCAAAGTGAAGAAGAAGGAGAGGGAAACGAAGAAGCACGAGGAGAAGAGAGAGAAGATAAAGGAGCAAAGCAGCGATGGGGCTGAAGGTAAAGCTACCAAAAGGGAAGGTGAGGAAGAGGAGTTGGTGGGTGAGGAGGCCAAACCTAGGGTAGAAAAGAATCAGAAAGAGAAGATTAAAGAGAGAGGAAAAAAAAGCTCCAAGGATGAGGCCGCTAGAGACAAAAAGCAGCCTTCTCGGAAACGCAAAAGCACTGAAACCGAAGGGACGGAAGCCAAAAAGGCAAAAGATGCGGCCAAAAAGGAGGAAGAATCAAAGTGGAAATGGTGGGAGGAGGAGCACTACGAGGATGGCATGAAGTGGAAATTCCTGGAACACAGGGGCCCATATTTTGCCCCTCCGTATGAGCCCCTCCCGGATGATGTCAGCTTCTACTATGATGGG
                                                  Xt7.1-CHK-1008235210                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAATATACAGGAACAAAAAGGGGGGTTGCCATGCAAAACTGAAAAGGAAAGAGACGGCCATCACAAATCCAAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTCAGAGAAAAAGGAAAAGGGGGATTCAGAGAAAAAGGAAAGGGGGAAAAACCATTTGTGTAGAGATTCAGAGGGGGGGAAAGAAAGTTTAAAAAGGGGCAAAGAAAACAAAGAGTCTAAAAGCGAGCAGAAAGCCATTGATGGGACTGAAGGCATCACCCAGCCAGAAAGAGAGAAGAAATGTGAAGATAAAATGGCATCAGGGAAAGAGAGAGAATCTGCCGAGGAGAAGGAAACTGGTAAGAGAGACCCCCTGAAATCCAAAGATAAAACATCTGCTGGGGAGGAAAGAAAGCCAAAAAAGCATTCTCACAAAGAGAAGTCCAAAGAGATGAACAGAACAAGAGAGAAGATGGAAGATGCTAAGATGTCAGTGTCTCGTGACCATCACAGGAAAGGAGATGCCCTGGAGGGGGCAGTGGAAGCCAACGAGGCAGTAAAACCTGAAAGAATTGAGGTGGCTGTTGGGGAACCCAAGGAACACAGCAGGGAAGTAGATGAGAAGGTCCATCTCAGGGTAAAGAGCTTCGAGGAGGAGCTGAATGAGTTGGCCAACCTGAAAATGCAGAGCAGCAAAGTGAAGAAGAAGGAGAGGGAAACGAAGAAGCACGAGGAGAAGAGAGAGAAGATAAAGGAGCAAAGCAGCGATGGGGCTGAAGGTAAAGCTACCAAAAGGGAAGGTGAGGAAGAGGAGTTGGTGGGTGAGGAGGCCAAACCTAGGGTAGAAAAGAATCAGAAAGAGAAGATTAAAGAGAGAGGAAAAAAAAGCTCCAAGGATGAGGCCGCTAGAGACAAAAAGCAGCCTTCTCGGAAACGCAAAAGCACTGAAACCGAAGGGACGGAAGCCAAAAAGGCAAAAGATGCGGCCAAAAAGGAGGAAGAATCAAAGTGGAAATGGTGGGAGGAGGAGCACTACGAGGATGGCATGAAGTGGAAATTCCTGGAACACAGGGGCCCATATTTTGCCCCTCCATATGAGCCCCTCCCGGATGATGTCAGCTTCTACTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     5     4     4     4     4     3     3     3     3     3     3     3     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     2     3     2     3     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----T------
                                               BLH ATG      39     290                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH MIN      39      52                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               BLH OVR      39      37                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               CDS MIN      39      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               EST CLI     -11      21                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                               ORF LNG      39       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                       PROTEIN --- Ci ---- 2e-009     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sc ---- 3e-018     NP_014637.1 topoisomerase I; Top1p [Saccharomyces cerevisiae] =======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 2e-024     NP_493337.1 Eukaryotic DNA topoisomerase I (94.0 kD) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 3e-026     XP_001183557.1 PREDICTED: similar to P1725, partial [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Dm ---- 6e-029     NP_608540.1 CG2839-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 6e-031     NP_003277.1 DNA topoisomerase I; type I DNA topoisomerase [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 2e-031     NP_033434.2 topoisomerase (DNA) I [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dr ---- 2e-032     NP_001037789.1 topoisomerase (DNA) I, like [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 4e-033     NP_990441.1 DNA topoisomerase I [Gallus gallus] -----------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN -== Xl ==== 2e-036     AAB36608.1 DNA topoisomerase I [Xenopus laevis]  =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN -== ?? ==== 2e-036     NP_001084031.1 DNA topoisomerase I [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 4e-155     AAI22924.1 Unknown (protein for IMAGE:7683037) [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM9354.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  0   1   1           Gas  FLt3                   TGas096k12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGGAGCGCGCAGCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTTCGTGCCAAACCAGGAAAAATGAACCTAATGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAAAAAAAAAAAAAAAAA
  5   1   1           Egg  FLt3                   TEgg120g02.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCGCAGCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGTCGCGGGGAGGACGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCCGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCCCAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAATCAGTGGAACCAAGTGACGGCAGAAAGGAGACGTCTTGTGAAGTCACCACGCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATCTGCACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAGTGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAATATACAGGAACAAAAAGGGGAAAGAGACGGCCATCACAAATCCAAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTCAGAGAAAAAGGAAAGGGGGAAAAACCATTTGTGTAGAGATTCAGAGGGGGGGAAAGAAAGTTTAAAAAGGGGCAAAGAAAACAAAGAGTCTAAAAGCGAGCAGAAAGCCATTGATGGGACTGAAGGCATCGCCCAGCCAGAAAGAGAGAAGAAATGTGAAGATAAAATGGCATCAGGGAAAGAGAGAGAATCTGCCGAGGAGAAGGAAACTGGTAAGAGAGACCCCCTGAAATCCAAAGATAAAACATCTGCTGGGGAGGAAAGAAAGCCAAAAAAGCATTCTCACAAAGAGAAGTCCAAAGAGATGAACAGAACAAGAGAGAAGATGGAAGATGCTAAGATGTCAGTGTCTCGTGACCATCACAGGAAAGGAGATGCCCTGGAGGGGGCAGTGGAAGCCAACGAGGCAGTAAAACCTGAAAGAATTGAGGTGGCTGTTGGGGAACCCAAGGAACACAGCAGGGAAGTAGATGAGAAGGTCCATCTGAGGGTAAAGAGCTTCGAGGAGGAGCTGAATGAGTTGGCCAACCTGAAAATGCAGAGCAGCAAAGTGAAGAAGAAGGAGAGGGAAACGAAGAAGCACGAGGGGAAGAGAGAGAAGATAAAGGAGCAAAGCAGCGATGGGGCTGAAGGTAAAGCTACCAAAAGGGAAGGTGAGGAAGAGGAGTTGGTGGGTGAGGAGGCCAAACCTAGGGTAGAAAAAAAAAAAAAAAAAA
  0   1   1           Te3  FLt3                        CAAM9354.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGTGGGGAAAGGCCTGAGTGAAACCATTGTCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAATATACAGGAACAAAAAGGGGGGTTGCCATGCAAAACTGAAAAGGAAAGAGACGGCCATCACAAATCCAAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTCAAAAAAAAAAAAAAA
  5   1   2      seed Egg  5g                        TEgg105m23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGGAGCGCGCAGCGTGTGGGGAAAGGCCTGAGCTTGTACTGAACTGTAACTCTCATTCCACTTCCTGTTCCACCCAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCC
  3   1   2       bld Gas  FLt3 in                    TGas096k12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGGAGCGCGCAGCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTTCGTGCCAAACCAGGAAAAATGAACCTAATGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACANCTGGACCCCCCGCATAAGCAAAGATAACAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  FLt3 in                  TGas096k12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAGCGCGCAGCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTTCGTGCCAAACCAGGAAAAATGAACCTAATGGGGAGA
  5   1   2       bld Egg  5g                        TEgg115m10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGCGCAGCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAATGGGGAGAAGTCTACTGCTGAACCCAATGC
  5   1   2       bld Egg  FLt3                      TEgg120g02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCGCAGCGTGTGGGGAAAGGCCTGAGTGAAACCATTGGCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGTCGCGGGGAGGACGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCCGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCCCAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAATCAGTGGAACCAAGTGACGGCAGAAAGGAGACGTCTTGTGAAGTCACCACGCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATCTGCACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAGTGCTGGAGAAGAGACGAGAAGAG
  5   1   2       bld Te3  FLt3 in                         CAAM9354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGGGGAAAGGCCTGAGTGAAACCATTGTCTCCTGATGGCAGCAGATGACGCTCAGACTCTCCATCGCCGCGGGGAGGATGCAAAATCGAGGGGCCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAATATACAGGAACAAAAAGGGGGGTTGCCATGCAAAACTGANAAGGAAAGAGACGGCCATCACAAATCCAAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTCAAAAAAAAAAAAAA
  3   1   2       bld Te3  FLt3 in                         CAAM9354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACAAGGAGAAGGGCCACAGTAAATCTGAACCTGTGAAGCTGAACAGAAGCAGTCTAGTCAGGGATGAGACCGTATCTTCTACCAACCCCACTGCTGAGGAGCCTCCCAGGAGGAGGAAGCACAGACTGGAGAAGGATGAAAAGGCCAAGTCTGCCGAAAGTTCCGCTCATATAAAGAAAATCAAATCTCACAATCACCACACAGAAAGTGATACTGGAGAGCCCCTACCCAAGCACAAAAAGGCAGACAATTCCCTCACAGAAAAGCTGCTGCAGGACGGTGTGATCTCCAGCGCCGCAGAAAATGGGTTCTATAAGTCAGTGGAACCGAGTGATGGCAGAAAGGAGATGTCTTGTGAAGTCACCACCCGACTGGATGAGAACAGCAACATCACCGCAATGGAGTGCAATGGGGAATTTACACTTTACAGAGAGGATAAGGGGGTAGAATCTCCGTGCCAAACCAGGAAAAATGAACCTAACGGGGAGAGTTCTACTGCTGAACCCAATGCTGGAGAAGAGACGAGAAGAGAAGGACTCTGGGAGAGTACGGCAGATAGTAGGGCTACACTGGACCCCCGCATAAGCAAAGATAACAGAAATATACAGGAACAAAAAGGGGGGTTGCCATGCAAAACTGAAAAGGAAAGAGACGGCCATCACAAATCCAAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTC
  3   1   2      skin Egg                             TEgg032e22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGTAAAAAAGGATAACGTTGATAGGTCTGAGAGGAAAAAGGATCATGTGGAGAAAAGTGGGGATTCAGAGAAAAAGGAAAAGGGGGATTCAGAGAAAAAGGAAAGGGGGAAAAACCATTTGTGTAGAGATTCAGAGGGGGGGAAAGAAAGTTTAAAAAGGGGCAAAGAAAACAAAGAGTCTAAAAGCGAGCAGAAAGCCATTGATGGGACTGAAGGCATCACCCAGCCAGAAAGAGAGAAGAAATGTGAAGATAAAATGGCATCAGGGAAAGAGAGAGAATCTGCCGAGGAGAAGGAAACTGGTAAGAGAGACCCCCTGAAATCCAAAGATAAAACATCTGCTGGGGAGGAAAGAAAGCCAAAAAAGCATTCTCACAAAGAGAAGTCCAAAGAGATGAACAGAACAAGAGAGAAGATGGAAGATGCTAAGATGTCAGTGTCTCGTGACCATCACAGGAAAGGAGATGCCCTGGAGGGGGCAGTGGAAGCCAACGAGGCAGTAAAACCTGAAAGAATTGAGGTGGCTGTTGGGGAACCCAAGGAACACAGCAGGGAAGTAGATGAGAAGGTCCATCTGAGGGTAAAGAGCTTCGAGGAGGAGCTGAATGAGTTGGCCAACCTGAAAATGCAAAGCAGCAAAGTGAAGAAGAAGGAGAGGGAAACGAAGAAGCACGAGGAGAAGAGAGGAGAGAAGATAAAGGAGCAAAGCAGCGATGGGGCTGAAGGTAAAGCTACCAAAAGGGAAGGTGAGGAAGAGGAGTTGGTGGGTGAGGAGGCCAAACCTAGGGTAGAAAAGAATCAGAAAGAGAAGATTAAAAAAAAAAAAAAAAAA
  5   1   1       add Egg       ?                    TEgg007j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAGAAAAGATTCTATAAGCTAGCAGAAAGCCATTGATGGGACTGAAGGCATCGCCCAGCCAGAAAGACAGAAGAAATGTGAGGATCAAATGGCATCAGGGCAAAGAGAGAGAATCTGCCAAGGAGAAGGAAACTGGTAAGAGAGACCCCCTGAAATCCGAAGATAAAACATCTGCTGGGGAGGAAAGAAAGCCAAAAAAGCATTCTCACAAAGAGAAGTCCGACGAGATGAACAGAACAAGAGAGAAGATGGGAGATGCTAAAATGTCAGTGTCTCGTGACCATCACAGGAAAGGAGATGCCCTGGAGGGGGCAGCGGAAGCCAACGATGCAGTAGAACCTGAAAGAATTGAGGTGGCTGTTGGGGAACCCAAGGAACACAGCAGGGAAGTAGATGAGAATGTCCATCTCAGGGTAAAGAGCTTCGAGGAGGAGCTGAATGAGTTGGCCAACCTGAAAATGCAGAGCAGCAAAGTGAAGAAGAAGGAGAGGGAAACGAAGAAGCGCGAGGAGAAGAGAGAGAAGATAAAGGAGCAAAGCAGCGATGGGGCTGAAGGTAAAGCTACCAAAAGGGAAGGTGAGGAAGAGGATTTGGTGGGTGAGGAGGCCAAAC
  5   1   2      skin Gas7 PIPE out                        XZG20769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGAGAAGTCCAAAGAGATGAACAGAACAAGAGAGAAGATGGAAGATGCTAAGATGTCAGTGTCTCGTGACCATCACAGGAAAGGAGATGCCCTGGAGGGGGCAGTGGAAGCCAACGAGGCAGTAAAACCTGAAAGAATTGAGGTGGCTGTTGGGGAACCCAAGGAACACAGCAGGGAAGTAGATGAGAAGGTCCATCTCAGGGTAAAGAGCTTCGAGGAGGAGCTGAATGAGTTGGCCAACCTGAAAATGCAGAGCAGCAAAGTGAAGAAGAAGGAGAGGGAAACGAAGAAGCACGAGGAGAAGAGAGAGAAGATAAAGGAGCAAAGCAGCGATGGGGCTGAAGGTAAAGCTACCAAAAGGGAAGGTGAGGAAGAGGAGTTGGTGGGTGAGGAGGCCAAACCTAGGGTAGAAAAGAATCAGAAAGAGAAGATTAAAGAGAGAGGAAAAAAAAGCTCCAAGGATGAGGCCGCTAGAGACAAAAAGCAGCCTTCTCGGAAACGCAAAAGCACTGAAACCGAAGGGACGGAAGCCAAAAAGGCAAAAGATGCGGCCAAAAAGGAGGAAGAATCAAAGTGGAAATGGTGGGAGGAGGAGCACTACGAGGATGGCATGAAGTGGAAATTCCTGGAACACAGGGGCCCATATTTTGCCCCTCCGTATGAGCCCCTCCCGGATGATGTCAGCTTCTACTATGATGGGAAGCC
  5   1   0       add Gas                            TGas035e23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAAGAGCAAAGCACGATGGGGCTGAAGTAAAGCTCCAAAAGGAAGGTGAGGAAGAGGAGTTGGTGGGTGAGGAGGCCAAACCTAGGGTANGAAAAGAATCAGAAAGAGAAGATTAAAGAGAAAGGAAAAAAAAGCTCCAAGGATGAGGCCGCTAGAGACAAAAAGCAGCCTTCTCGGAAACGCAAAAGCACTGAAACCGAAGGGACGGAAGCCAAAAAGGCAAAAGATGCGGCCAAAAAGGAGGAAGAATCAAAGTGGAAATGGTGGGAGGAGGAGCACTACGAGGATGGCATGAAGTGGAAATTCCTGGAACACAGGGGCCCATATTTTGCCCCTCCATATGAGCCCCTCCCGGATGATGTCAGCTTCTACTATGATGGGAAGCCAGTGAAACTGAGCCCAGGGGCCGAGGAAGTGGCCACTTTCTATGGCAAAATGCTGGACCATGAGTATACTACCAAGGAGGCGTTCCAGAAGAACTTCTTCGCAGACTGGAGAGAGCAAATGACGAATGAGGAGCGGAAGCTGATCAAGCACCTACACAAGTGTGAATTCTCCGAGATCCACAAGTATTTCTTTGAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)