Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI11859.3                           8 END     4          40       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 276.0    0Xt7.1-TTbA015k14.5                          8 PI      79        600      966                paired box protein [Xenopus laevis]
     3 200.0    0Xt7.1-CABI11353.5                           4 PI      76        601      948                Paired box protein Pax-8

 This cluster: approximate FL confidence score = 94%

 1012086104 Xt7.1-CABI11859.5 - 10 ESTs
                                                                       ......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI11859.5                                                         CTCCATTCTCCAGCCAAACCTCCTAGCACACACATCCCACCTTAAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGACACCGTGCCCAGTGTGTCCTCCATAAACAGCAAACAGACTTAAAGCCGCAAATAAGCCAGCCATTCTCGCACGTGTAAAACTGGTCAGGATTACGAGGCGTTTACGTAGGATTCTTCTCGTAACCCAAACTTTGATTGACAAACAGAAAACACTTTGTGAGGAACCCCTTTTCCTGCTTGTTCACTGGCAATTACTGGCTTTAATGGATTAAAAAA
                                                  Xt7.1-CHK-1008236371                                                               TCTCCAGCCAAACCTCCTAGCACACACATCCCACCTTAAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGACACCGTGCCCAGTGTGTCCTCCATAAACAGCAAACAGACTTAAAGCCGCAAATAAGCCAGCCATTCTCGCACGTGTAAAACTGGTCAGGATTACGAGGCGTTTACGTAGGATTCTTCTCGTAACCCAAACTTTGATTGACAAACAGAAAACACTTTGTGAGGAACCCCTTTTCCTGCTTGTTCACTGGCAATTACTGGCTTTAATGGATTAAAAAAAAAAAA
                                                      consensus depths                                                              2     2     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     9     7     9     7     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     5     4     5     4     5     3     4     3     4     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     3
                                               BLH ATG     556     224                                                         
                                               BLH MIN     556      99                                                         
                                               BLH MPR      79      99                                                         
                                               BLH OVR     556     975                                                         
                                               CDS MIN     556      99                                                         
                                               ORF LNG     556      11                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN -== Br ==== 1e-048     CAB42656.1 amphipax1 protein [Branchiostoma lanceolatum] =====================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 2e-050     NP_500513.1 paired box protein (38.5 kD) (4E962) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sp ---- 6e-051     NP_999759.1 paired box protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-059     BAC41498.1 Pax-2/5/8 [Ciona intestinalis] -----===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN --- Dm ---- 7e-059     NP_524633.3 CG11049-PA, isoform A [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 9e-066     AAC12733.1 paired box protein Pax-2 alpha isoform [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bb ---- 9e-066     ABK54277.1 Pax-2 [Branchiostoma belcheri] =================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 2e-071     NP_035167.2 paired box gene 2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 9e-073     NP_571715.1 paired box gene 2b [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 1e-076     NP_003978.2 paired box protein 2 isoform a [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 1e-076     CAA04223.1 paired box protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === ?? ==== 1e-076     NP_001079830.1 paired box protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 6e-077     NP_990124.1 paired-box containing protein Pax-2 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 7e-079     CAJ82432.1 paired box gene 2 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI11859.5                                                                                                                                                                                                                            TGA---------------------------------------------------------------------------------------------------------------------------------ATG------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------ATG---ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TAA---------TAA---------------------------------------------------TAG---------------------------TGA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Neu  FL                     TNeu062i10.FL-Sanger                                                                               CTAGCACACACATCCCACCTTAAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGACACCGTGCCCAGTGTGTCCTCCATAAACAGCAAACAGACTTAAAGCCGCAAATAAGCCAGCCATTCTCGCACGTGTAAAACTGGTCAGGATTACGAGGCGTTTACGTAGGATTCTTCTCGTAACCCAAACTTTGATTGACAAACAGAAAACACTTTGTGAGGAACCCCTTTTCCTGCTTGTTCACTGGCAATTACTGGCTTTAATGGATTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g3  in                   TGas131c14.p1kSP6 GGGGGGTATCTGAGGGGCTTTGCAGCTTTTAGAGAGACACACACGGGGAGAGGAGGCTCCATTCTCCAGCCAAACCTCCTAGCACACACATCCCACCTTAAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAACTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTG
  5   1   2       bld TpA  5g3  out                  TTpA059f13.p1kSP6                                                         CTCCATTCTCCAGCCAAACCTCCTAGCACACACATCCCACCTTAAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATANACCTGGAGTTATTGGCGGATCCNAACCAGGTTGCTACTCCCAAGGTTGTCGACNAAATCGCTGAGTACAGAGACAAACCCTACAATGTTTGCT
  5   1   2   10  bld Tbd1 PIPE out                         CBXT621.b1 ....................................................................GCCAAACCTCCTAGCACACACATCCCACCTTAAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATT
  5   1   2       bld Neu  FL   in                   TNeu062i10.p1cSP6                                                                                 AGCACACACATCCCAACCTTAAGTGACAACTCCTGCCGGTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCAT
  5   1   2   10 seed Ovi1 5g3  out                       CABI11859.5p ......................................................................................................................GTCTCTCCATTTTAGGGATATTTTGCAGCCCCCCCCAAACAAATCACACACCCCTGGATTCTTTTTTTCCTCTGCTTTTCGCCTCCTGCTTAACTTTGCGTTGAAGTCAGACAAGTCCAGCCAAAGACTTTGGAGGAAAGCAAACTCACCTTGCACCTTGTGCTGCTGCTCGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGA
  3   1   2       bld Gas  5g3  in                    TGas131c14.q1kT7                                                                                                                                                                                                                                                                                                 CGCCACTGGCTTTTTGCCTCGCTGCCCTACAAGCCTGCTCCAGGAGAGAGCTGTAGTTATGCCATGCACCTGCCGCCCTGAGATTTGCTCCTGTGCCCGGGAAGGCTGCTGAAGGGAACTCGTTCCAAGCTTCCTGACTTGCCTCTGCCTTCGCCCCACGCTGCCCGCACTGCTGCCATTCCTGCCTCCAGCTCCAGCAGCAGAGGGGGAGAGGGGAGTACAGCGCAGCTCAGACCCTCCACCTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGACACCGTGCCCAGTGTGTCCTCCATAAACAGCAAACAGACTTAAAGCCGCAAATAAGCCAGCCATTCTCGCACGTGTAAAACTGGTCAGGATTACGAGGCGTTTACGTAGGATTCTTCTCGTAACCCAAACTTTGATTGACAAACAGAAAACACTTTGTGAGGAACCCCTTTTCCTGCTTGTTCACGGCAATTACTGGCTTAATGGATAAAAAAAAAAAAAA
  3   1   2       bld Neu  FL   in                    TNeu062i10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCAGAGGNNGGGAGAGGGGAGTANNCAGCGCAGCTTTCAGACCCTCCACCNTGATTTTCTTCAAGTCTTGAAGTTCAGTCCAGAGGCGAAACGGCGACTACAGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCCAGGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGACACCGTGCCCAGTGTGTCCTCCATAAACAGCAAACAGACTTAAAGCCGCAAATAAGCCAGCCATTCTCGCACGTGTAAAACTGGTCAGGATTACGAGGCGTTTACGTAGGATTCTTCTCGTAACCCAAACTTTGATTGACAAACAGAAAACACTTTGTGAGGAACCCCTTTTCCTGCTTGTTCACTGGCAATTACTGGCTTTAATGGATTAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA  5x                       THdA027p14.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGACTACAGCCTAATTCCTCCCCTTCCTTTGCCTCCCCATGGATATGCTCTGCAACGGCAGATCCCTTCTCTGCCATGCACCGGCTTGGGGGTGTGAACCAGCTCGAGGGGGTATTTGTCGCTGGCTATACCCCTACCTGATGTGGTGACACAAAGGATAGTGGAACTGGCCCATCTGGGACTGAGACCCTGTGATATT
  5   1   2   12  bld Te1  5g3  out                        CBWN4907.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCCGAATTCCTCCCCTTCATTTGCCTCCCCATGGATATGCACTGCAAGGCAGATCCCTTCTCGGCCATGCACCGGCATGGGGGTGTGAACCAGCTCGGGGGGGTATTTGTCAATGGCAGACCCCTACCTGATGTGGTGAGACAGAGGATAGTGGAACTGGCCCATCAAGGAGTGAGACCCTGTGATATTTCCAGGCAGCTGAGGGTCAGCCATGGATGTGTGAGCAAGATCCTGGGCAGGTACTATGAGACGGGGAGCATTAAACCTGGAGTTATTGGCGGATCCAAACCCAAGGTTGCTACTCCCAAGGTTGTCGACAAAATCGCTGAGTACAAGAGACAAAACCCTACAATGTTTGCTTGGGAAATCCGGGACAGGCTTTTGGCTGAAGGAATCTGTGACAATGACACCGTGCCCAGTGTGTCCTCCATAAACAGAATTATCAGAACGAAAGTCCAACAGCCATTCCATCCAACCCCAGACGGATCTGGAACGCCAGTAAGCACACCGGGGCATACTCTTGTTCCCAGTACAGCATCTCCTCCTGTCTCCAGCGCATCCAATGATCCCGTAGGCTCTTATTCCATTAATGGAATCCTGGGTATTCCTCGTTCTAATGGCGAAAAGAGGAAACGCGATGAAGATGGATCTGATGGTTCTGGTCCAAATGGAGATTCCCAGAGTAGCGTTGAAAGTTTACGGAAGCATTTACGGGCTGATAACTTCACCCAGCAGCAACTGGAGGCGTTAGATC
  5   1   1       add Gas                            TGas058k14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATTTCCAGACAATCACAGGGCCTAGCTGCTGAACCATTAAAATACCAATGTTTATTTCTCTTAAGCAAACAGACTTAAAGCCGCAAATAAGCCAGCCATTCTCGCACGTGTAAAACTGGTCAGGATTACGAGGCGTTTACGTAGGATTCTTCTCGTAACCCAAACTTTGATTGACAAACAGAAAACACTTTGTGAGGAACCCCTTTTCCTGCTTGTTCACTGGCAATTACTGGCTTTAATGGATTAAAAAAAAAAAAAAAGACAATGCATGTGTGCTGTGTCTTTAAAGATACCTTTAAAGGCATTTTAAGTCATAATATCACAAGACCCAAATACCCACACACAAACCCACTCAACATGCAAGCGCTGGCATGTACCGTGCCATTAAATAAAGCAAATAAATCTGTTCATATGTTTTTGTTTTCCGCTATCTTGATTAATATCTGCGCTGTGTTATTATGTTTGTAAGATAAATAAATAGATGGCGCAGCTCTAATTAGAAATGCAATGCAAATACAAAGCAGAAAATACCATTTAGATATTATCTGTTCCAATTGCACTGGCATCCCACGTAAATGTTTTTAATATTTCACAAATGACATGGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)