Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN3929.3                           11 END     8          57       72                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 297.0    0Xt7.1-TGas108b03.3.5                      113 PI      74       1832     2476                Rfx3 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012086401 Xt7.1-XZT35688.5 - 14 ESTs
                                                                       .-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT35688.5                                                                                                                                                                                                                                                                      CGGAGCGGCCATAGCCACGGTAGTCGTGGCGACAAGAACCCCGGCAACAAGAATCAACAACAACAACGACCAGCAACTCGGGACCCCCCCCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGCGGCTGGTGGTGCAGAGCTCCCCTCAGGGCACTAAGGCAGCACAGGTCTCCCTAACAGTACACACAGTGCAGCAGCAGCCAGCACACTCCCCTCCTGATGGGGACAGCCCATCTCTGAAAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGAGGGAACCGACGCCACATACACTGGCAGCACCATCCGATCAGGGTCCTACCCCTACACCGAGACTCCCCTTTACACCCAGGCTACGGGATCTACATACTACGAGGCGCAGGGAGCCACAGGGCAGGTCAGCTCTCCCACCTCATCCCCAGCTTTGGCCAGCAGCCCATCGGTGCCCATGTATGTGTCTGGGGGGCAGATTCTCACCAACACCACCCAGTCCGCGGCCTCAGGTGGAACTGGAGGAGGTGGTAGTGGATCAGGAACGGGGACCTACGTTATCCAGGGTGGATTTATCATGGGCAGCTCTACCCAGTCCTACTCTCATACCACACGTGCCTCGCCAGCCACGGTACAGTGGCTGCTTGATAACTACGAGACGGCAGAGGGGGTGAGCCTGCCCCGCAGCACCCTGTACTGCCACTACTTACTGCACTGCCAGGAGCAAAAACTGGAGCCTGTAAATGCCGCCTCTTTCGGGAAGCTCATCCGCTCGGTCTTCATGGGCCTGAGAACCCGCCGACTGGGCACGAGGGGGAACTCTAAGTACCACTATTACGGCCTGCGAATCAAAGCCAGCTCCCCACTTCTGCGCCTGATGGAGGACCAGCAGCACCTCGCTATGCGCCAGCAGCCCTTCTCCCAGAAACAGAGGCTAAAAACCGTGCAGAAGATGGAAGGTATGAGTAACGGGGTGGGGGGCTCCCAGCAGCAAGCGTCGGGTCTGTCTGACATCAGCGCTCAGGTGCAGCAGTACCAGCAGTTTTTAGATGCTTCAAAGACACTTCCAGAGTTTGCAGAGATGGATTTGCAGGGGAAGCCGCTCCCTGATGGCGTGACTCTGGCCAATGTGAAGGCTTTCCAGTTACTGTACAGGGAGCACTGCGAGGCTATAGTGGATGTGGTTGTGAATTTGCAGTTCACCTTGGTAGAGACCCTGTGGAAAACCTTTTGGAGGTTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTAAATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACACAAGCTATTCGCAACTTTGCCAAGAGCCTGGAGAGCTGGCTGACGAGCGCCATGATGAACATACCCGAGGAGATGGTGCGGGTTAAGGCCAGCGCTGCAAGTGCCTTTGCCCAGACATTGCGGCGATACACGTCTCTGAATCACCTTGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTACCAGGGGAGCCCAGGATTTCCCAAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATGGTGATAAGGGATCTGACCCTCCGCAGCGCCGCCAGTTTTGGGTCTTTCCACCTGATCCGGCTGTTGTACGACGAGTACATGTACTACCTGATAGAGCACCGCGTGGCACAGGCTCGCGGGGAGACACCAATCGCTGTCATGGGGGAGTTTGCAAACCCGGGCAACGCATTGCGCACACTGGA
                                                  Xt7.1-CHK-1008233118                                                                                                                                                                                                                                                                            GGCCATAGCCACGGTAGTCGTGGCGACAAGAACCCCGGCAACAAGAATCAACAACAACAACGACCAGCAACTCGGGACCCCCCCCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGCGGCTGGTGGTGCAGAGCTCCCCTCAGGGCACTAAGGCAGCACAGGTCTCCCTAACAGTACACACAGTGCAGCAGCAGCCAGCACACTCCCCTCCTGATGGGGACAGCCCATCxCTGAxAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGAGGGAACCGACGCCACATACACTGGCAGCACCATCCGATCAGGGTCCTACCCCTACACCGAGACTCCCCTTTACACCCAGGCTACGGGATCTACATACTACGAGGCGCAGGGAGCCACAGGGCAGGTCAGCTCTCCCACCTCATCCCCAGCTTTGGCCAGCAGCCCATCGGTGCCCATGTATGTGTCTGGGGGGCAGATTCTCACCAACACCACCCAGTCCGCGGCCTCAGGTGGAACTGGAGGAGGTGGTAGTGGATCAGGAACGGGGACCTACGTTATCCAGGGTGGATTTATCATGGGCAGCTCTACCCAGTCCTACTCTCATACCACACGTGCCTCGCCAGCCACGGTACAGTGGCTGCTTGATAACTACGAGACGGCAGAGGGGGTGAGCCTGCCCCGCAGCACCCTGTACTGCCACTACTTACTGCACTGCCAGGAGCAAAAACTGGAGCCTGTAAATGCCGCCTCTTTCGGGAAGCTCATCCGCTCGGTCTTCATGGGCCTGAGAACCCGCCGACTGGGCACGAGGGGGAACTCTAAGTACCACTATTACGGCCTGCGAATCAAAGCCAGCTCCCCACTTCTGCGCCTGATGGAGGACCAGCAGCACCTCGCTATGCGCCAGCAGCCCTTCTCCCAGAAACAGAGGCTAAAAACCGTGCAGAAGATGGAAGGTATGAGTAACGGGGTGGGGGGCTCCCAGCAGCAAGCGTCGGGTCTGTCTGACATCAGCGCTCAGGTGCAGCAGTACCAGCAGTTTTTAGATGCTTCAAAGACACTTCCAGAGTTTGCAGAGATGGATTTGCAGGGGAAGCCGCTCCCTGATGGCGTGACTCTGGCCAATGTGAAGGCTTTCCAGTTACTGTACAGGGAGCACTGCGAGGCTATAGTGGATGTGGTTGTGAATTTGCAGTTCACCTTGGTAGAGACCCTGTGGAAAACCTTTTGGAGGTTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTAAATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACACAAGCTATTCGCAACTTTGCCAAGAGCCTGGAGAGCTGGCTGACGAGCGCCATGATGAACATACCCGAGGAGATGGTGCGGGTTAAGGCCAGCGCTGCAAGTGCCTTTGCCCAGACATTGCGGCGATACACGTCTCTGAATCACCTTGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTACCAGGGGAGCCCAGGATTTCCCAAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATGGTGATAAGGGATCTGACCCTCCGCAGCGCCGCCAGTTTTGGGTCTTTCCACCTGATCCGGCTGTTGTACGACGAGTACATGTACTACCTGATAGAGCACCGCGTGGCACAGGCTCGCGGGGAGACACCAATCGCTGTCATGGGGGAGTTTGCAAACCCGGGCAACGCATTGCGCACACTGGACCAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                           2     2     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     3     6     3     6     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     2     3     1     3     1     3     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     2     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAGGACAAGC
                                               BLH MIN     226     306                                                                                                                                                                                                                                                                      
                                               BLH OVR     229     153                                                                                                                                                                                                                                                                      
                                               EST CLI       0       7                                                                                                                                                                                                                                                                      
                                               ORF LNG     229     203                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sc ---- 8e-014     NP_013277.1 DNA binding protein, homologous to a family of mammalian RFX1-4 proteins whichhave a novel highly conserved DNA binding domain; Rfx1p [Saccharomycescerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 8e-090     NP_001022139.1 abnormal DAuer Formation family member (daf-19) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 4e-151     NP_649999.2 CG6312-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 0          BAE06671.1 regulatory factor X [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 0          XP_790942.2 PREDICTED: similar to regulatory factor X3 [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 0          XP_418212.2 PREDICTED: hypothetical protein [Gallus gallus] --=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAI08518.1 MGC130921 protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - ?? ---- 0          XP_690621.1 PREDICTED: similar to MHC class II regulatory factor RFX1 (RFX) (Enhancer factor C) (EF-C) [Danio rerio] -----------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 0          AAI21501.1 Rfx3 protein [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 0          XP_682728.1 PREDICTED: similar to DNA-binding protein RFX1 [Danio rerio] -------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 0          NP_033081.2 regulatory factor X, 1 (influences HLA class II expression) [Mus musculus] -----------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 0          NP_002909.3 regulatory factor X1 [Homo sapiens] --------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT35688.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  5   1   2   16  bld Te4  5g3  out                        CAAN9029.5p CAAGAGGGCCGATACTACTTGGCCATGTAACCAATGACAACAATTTCCCTGCAGAATGACATGTACGCTTTCCTACAGGGAACGGCCGAGCCCCTATTACGACCGCCCACATATCTGACAGACGTTTTTGCCATCCAATTAGAGCTTTGCTCTCTATTGATGGACGTCAACAGTAACCAATTGATCCGCTGCTTCTCGGACCTTTACTGACGACTTCAGTGAAGGGGGAGGGTCGGTAGCAACAGTTGCCCGGGTGAGGGACGGAGCGGCCATAGCCACGGTAGTCGTGGCGACAAGAACCCCGGCAACAAGAATCAACAACAACAACGACCAGCAACTCGGGACCCCCCCCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGCGGCTGGTGGTGCAGAGCTCCCCTCAGGGCACTAAGGCAGCACAGGTCT
  5   1   2   14 seed Te4  5g3  out                        CAAN3929.5p .....................................................................................................................................................................................................................................................................CGGAGCGGCCATAGCCACGGTAGTCGTGGCGACAAGAACCCCGGCAACAAGAATCAACAACAACAACGACCAGCAACTCGGGACCCCCCCCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGCGGCTGGTGGTGCAGAGCTCCCCTCAGGGCACTAAGGCAGCACAGGTCTCCCTAACAGTACACACAGTGCAGCAGCAGCCAGCACACTCCCCTCCTGATGGGGACAGCCCATCTCTGAAGGCAGGACAAGCCCAGCCATTGCAGCTCCACGGAACGCAACAAGAGCGATCGGTCGTACAAGCGAATCCTCAGAAATCCTCCCCCGTTCATCAGCTGACAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGA
  5   1   2       bld Egg                            TEgg072d19.p1kSP6                                                                                                                                                                                                                                                                           CGGCCATAGCCACGGTAGTCGTGGCGACAAGAACCCCGGCAACAAGAATCAACAACAACAACGACCAGCAACTCGGGACCCCCACCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGCGGCTGGTGGTGCAGAGCTCCCCTCAGGGCACTAAGGCAGCACAGGTCTCCCTAACAGTACACACAGTGCAGCAGCAGCCAGCACACTCCCCTCCTGATGGGGACAGCCCATCTCTGAAGGCAGGACAAGCCCAGCCATTG
  5   1   2   14  bld Te3  5g3  out                        CAAM9202.5p ..............................................................................................................................................................................................................................................................................................................................CAACAACAACGACCAGCAACTCGGGACCCCCCCCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGGGGGACAGCCCATCTCTGAAGGCAGGACAAGCCCAGCCATTGCAGCTCCACGGAACGCAACAAGAGCGATCGGTCGTACAAGCGAATCCTCAGAAATCCTCCCCCGTTCATCAGCTGACAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGAGGGAACCGACGCCACATACACTGGCAGCACCATCCGATCAGGGTCCTACCCCTACACCGAGACTCCCCTTTACACCCAGGCTACGGGATCTACATACTACGAGGCGCAGGGAGC
  5   1   2       bld Te4       out                       CAAN11335.5p                                                                                                                                                                                                                                                                                                                                      AACGACCAGCAACTCGGGACCCCCCCCCTGGCCCACCTTCAACTAACGGGCAACCCGTCCCGTTATTATTTGTGTACAAATCACTTCCTTGCGGAACGGGGCACTACCCGAGGTGTGACGCTGAAGTGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGGGGGACAGCCCATCTCTGAAGGCAGGACAAGCCCAGCCATTGCAGCTCCACGGAACGCAACAAGAGCGATCGGTCGTACAAGCGAATCCTCAGAAATCCTCCCCCGTTCATCAGCTGACAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGAGGGAACCGACGCCACATACACTGGCAGCACCATCCGATCAGGGTCCTACCCCTACACCGAGACTCCCCTTTACACCCAGGCTACGGGATCTACATACTACGAAGCGCAGGGAGCCACAGGGCANGTACAGTGGCTGCTTGATAACTA
  5   1   2   14  bld Te4  5g3  out                        CAAN8160.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGAAGCCGTGTGCTTTGCTCCACCTGGGTAGCACCCATAATGGCGACTCAAGCCTACGTGACAGAGCTCCAGGCAGCTGCCCCTGCCGCCACGCAGGGCACCCCGCAGCAGTATGTGGCAGAACTGCAAGTCACCCCCTCCGGCAGTTCCCAGGCGTCAGGAGCCCAGACTCCCTCTGCGCAGCAGTACATTGTAGTGACCGTTTCGGAAGGGTCCGTGAGAGGCAGTGACGGGGAACTCAGCCCAGGGGGAACCCCCACACCCACAACCGGGGTGCCGACACAGGTGGTACAGCAAGTGCAAGCAGCACAGCAGCGGCTGGTGGTGCAGAGCTCCCCTCAGGGCACTAAGGCAGCACAGGTCTCCCTAACAGTACACACAGTGCAGCAGCAGCCAGCACACTCCCCTCCTGATGGGGACAGCCCATCTCTGAAGGCAGGACAAGCCCAGCCATTGCAGCTCCACGGAACGCAACAAGAGCGATCGGTCGTACAAGCGAATCCTCAGAAATCCTCCCCCGTTCATCAGCTGACAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGAGGGAACCGACGCCACATACACTGGCAGCACCATCCGATCAGGGTCCTACCCCTACACCGAGAC
  5   1   2       bld Te4       out                       CAAN11027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCGGGATTCGTCGACCCCGCGTCCGCAGCTGACAGTCCAGGCTCTTCAGCATGTCCAAGGGGCAGCCGAGGTTCAGCAGCTGCAGCAAGTCCCGGTGCAACACGTATACCCCAGCCAGGTGCAATATGTGGAGGGAACCGACGCCACATACACTGGCAGCACCATCCGATCAGGGTCCTACCCCTACACCGAGACTCCCCTTTACACCCAGGCTACGGGATCTACATACTACGAGGCGCAGGGAGCCACAGGGCAGGTCAGCTCTCCCACCTCATCCCCAGCTTTGGCCAGCAGCCCATCGGTGCCCATGTATGTGTCTGGGGGGCAGATTCTCACCAACACCACCCAGTCCGCGGCCTCAGGTGGAACTGGAGGAGGTGGTAGTGGATCAGGAACGGGGACCTACGTTATCCAGGGTGGATTTATCATGGGCAGCTCTACCCAGTCCTACTCTCATACCACACGTGCCTCGCCAGCCACGGTACAGTGGCTGCTTGATAACTACGAGACGGCAGAGGGGGTGAGCCTGCCCCGCAGCACCCTGTACTGCCACTACTTACTGCACTGCCAGGAGCAAAAACTGGAGCCTGTAAATGCCGCCTCTTTCGGGAAGCTCATCCGCTCGGTCTTCATGGGCCTGAGAACCCGCCGACTGGGCACGAGGGGGAACTCTAAGTACCACTATTACGGCCTGCGAATCAAAGCCAGCTCCCCACTTCTGCGCCTGATGGAGGACCAGCAGCACCTCGCTATGCGCCAGCAGCCCTTCTCC
  5   1   2      skin Te5       ?                          CAAO9827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCCTGTACTGCCACTACTTACTGCACTGCCAGGAGCAAAAACTGGAGGCTGTAAATGCCGCCTCTTTCGGGAAGCTCATCCGCTCGGTCTTCATGGGCCTGAGAACCCGCCGACTGGGCACGAGGGGGAACTCTAAGTACCACTATTACGGCCTGCGAATCAAAGCCAGCTCCCCACTTCTGCGCCTGATGGAGGACCAGCAGCACCTCGCTATGCGCCAGCAGCCCTTCTCCCAGAAACAGAGGCTAAAAACCGTGCAGAAGATGGAAGGTATGAGTAACGGGGTGGGGGGCTCCCAGCAGCAAGCGTCGGGTCTGTCTGACATCAGCGCTCAGGTGCAGCAGTACCAGCAGTTTTTAGATGCTTCAAAGACACTTCCAGAGTTTGCAGAGATGGATTTGCAGGGGAAGCCGCTCCCTGATGGCGTGACTCTGGCCAATGTGAAGGCTTTCCAGTTACTGTACAGGGAGCACTGCGAGGCTATAGTGGATGTGGTTGTGAATTTGCAGTTCACCTTGGTAGAGACCCTGTGGAAAACCTTTTGGAGGTTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTANATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACANCAGCTATTCGCAACT
  5   1   2      skin Te5       in                         CAAO7627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGGTATGAGTAACGGGGTGGGGGGCTCCCAGCAGCAAGCGTCGGGTCTGTCTGACATCAGCGCTCAGGTGCAGCAGTACCAGCAGTTTTTAGATGCTTCAAAGACACTTCCAGAGTTTGCAGAGATGGATTTGCAGGGGAAGCCGCTCCCTGATGGCGTGACTCTGGCCAATGTGAAGGCTTTCCAGTTACTGTACAGGGAGCACTGCGAGGCTATAGTGGATGTGGTTGTGAATTTGCAGTTCACCTTGGTAGAGACCCTGTGGAAAACCTTTTGGAGGTTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTAAATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACACAAGCTATTCGCAACTTTGCCAAGAGCCTGGAGAGCTGGCTGACGAGCGCCATGATGAACATACCCGAGGAGATGGTGCGGGTTAAGGCCAGCGCTGCAAGTGCCTTTGCCCAGACATTGCGGCGATACACGTCTCTGAATCACCTTGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGNCATGGGCAGAGTGGCTGGATAGTGTCGTCTCC
  5   1   2       bld Te3       out                        CAAM2560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGTGCAGCACTACCAGCAGTTTTTAGATGCTTCAAAGACACTTCCAGAGTTTGCAGAGATGGATTTGCAGGGGAAGCCGCTCCCTGATGGCGTGACTCTGGCCAATGTGAAGGCTTTCCAGTTACTGTACAGGGAGCACTGCGAGGCTATAGTGGATGTGGTTGTGAATTTGCAGTTCACCTTGGTAGAGACCCTGTGGAAAACCTTTTGGAGGTTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTAAATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACACAAGCTATTCGCAACTTTGCCAAGAGCCTGGAGAGCTGGCTGACGAGCGCCATGATGAACATACCCGAGGAGATGGTGCGGGTTAAGGCCAGCGCTGCAAGTGCCTTTGCCCAGACATTGCGGCGATACACGTCTCTGAATCACCTTGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTATCAGGGGAGCCCAGGATTTCCCAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATG
  5   1   2       bld Tad5                                 XZT35688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTACAGGGAGCACTGCGAGGCTATAGTGGATGTGGTTGTGAATTTGCAGTTCACCTTGGTAGAGACCCTGTGGAAAACCTTTTGGAGGTTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTAAATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACACAAGCTATTCGCAACTTTGCCAAGAGCCTGGAGAGCTGGCTGACGAGCGCCATGATGAACATACCCGAGGAGATGGTGCGGGTTAAGGCCAGCGCTGCAAGTGCCTTTGCCCAGACATTGCGGCGATACACGTCTCTGAATCACCTTGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTACCAGGGGAGCCCAGGATTTCCCAAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATGGTGATAAGGGATCTGACCCTCCGCAGCGCCGCCAGTTTTGGGTCTTTCCACCTGATCCGGCTGTTGTACGACGAGTACATGTACTACCTGATAGAGCACCGCGTGGCAC
  3   1   2       bld Te5       in                         CAAO7627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCAACCAGACGCAGCACAGCGACAGCACAATAGACGATGAAGCAGAGAAGCGGCTGCCCAAGGACTGCCTAGTGCTGCTCTCCAAGTATGAGCCATTGCTTAAATGGAGCAGAGACTGTGATCATCTCCTCTATCAGGTTCTGGTGGAAACGCTCATCCCAGATGTACTGCGCCCCATACCAAGTGCCCTGACACAAGCTATTCGCAACTTTGCCAAGAGCCTGGAGAGCTGGCTGACGAGCGCCATGATGAACATACCCGAGGAGATGGTGCGGGTTAAGGCCAGCGCTGCAAGTGCCTTTGCCCAGACATTGCGGCGATACACGTCTCTGAATCACCTTGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTACCAGGGGAGCCCAGGATTTCCCAAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATGGTGATAAGGGATCTGACCCTCCGCAGCGCCGCCAGTTTTGGGTCTTTCCACCTGATCCGGCTGTTGTACGACGAGTACATGTACTACCTGATAGAGCACCGCGTGGCACAGGCTCGCGGGGAGACACCAATCGCTGTCATGGGGGAGTTTGCAAACCCGGGCAACGCATTGCGCACACTGGACCAAGAC
  5  -1   2       chi Te3       out                        CAAM7486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGCAGTCCTTGGGCAGCCGCTTCTCTGATTCATCGTCTATTGTGCTGTCGCTGTGCTGCGTCTGGTTGAACCTCCAAAAGGTTTTCCACAGGGTCTCTACCAAGGTGAACTGCAAATTCACAACCACATCCACTATAGCCTCGCAGTGCTCCCTGTACAGTAACTGGAAAGCCTTCACATTGGCCAGAGTCACGCCATCAGGGAGCGGCTTCCCCTGCAAATCCATCTCTGCAAACTCTGGAAGTGTCTTTGAAGCATCTAAAAACTGCTGGTACTGCTGCACCTGAGCGCTGATGTCAGACAGACCCGACGCTTGCTGCTGGGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTACCAGGGGAGCCCAGGATTTCCCAAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATGGTGATAAGGGATCTGACCCTCCGCAGCGCCGCCAGTTTTGGGTCTTTCCACCTGATCCGGCTGTTGTACGACGAGTACATGTACTACCTGATAGAGCACCGCGTGGCACAGGCTCGCGGGGAGACACCAATCGCTGTCATGGGGGAGTTTGCAAACCCNGGGCAACGCATTGCGCACACTGGACCAAGA
  5   1   2       bld Gas8                                   st9l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTCAGGCTGCCCGCGCCGTGCTGCAGAACACTGCCCAGATCAACCAAATGCTCAGCGATCTCAACCGTGTGGATTTCACCAACGTGCAGGAACAAGCCTCGTGGGTGTGCCGCTGTGCAGACCGGGTGGTACAGAGGCTGGAGCAGGACTTCAAGCTGACGCTACAGCAGCAGAGCTCCCTAGAGCAATGGGCAGAGTGGCTGGATAGTGTCGTCTCCCAGGTGCTGAAACCTTACCAGGGGAGCCCAGGATTTCCCAAGGCGGCCAAACTCTTCCTACTGAAGTGGTCCTTCTACAGCTCCATGGTGATAAGGGATCTGACCCTCCGCAGCGCCGCCAGTTTTGGGTCTTTCCACCTGATCCGGCTGTTGTACGACGAGTACATGTACTACCTGATAGAGCACCGCGTGGCACAGGCTCGCGGGGAGACACCAATCGCTGTCATGGGGGAGTTTGCAAACCCGGGCAACGCATTGCGCACACTGGACCAAGACAAAGAAGAAGAAGAGGAGGAGGAGGATGAGAGCGATGAAGATCTGACTCATGACTTGCCCCTCACCATGAGTGACCCCTCCGGTGCTTTGGGTTCTGATTCGCTGGAGCCTCCCGCTAAGCTGGCAAGGAGCGACTCCCAAGCAATCTTTGTACAGGTGCCTCCGACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)