Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD14382.5                          46 END     1           8        2                MGC89112 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012086525 Xt7.1-TTbA004c16.5 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA004c16.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTACAAAGTGGGGTTTGGAAGCCCATCTGGTGAATTTTGGCTGGGGAATGAGTTTATTTTCGCACTAACCAGCCAAAGGCAGTATTCTCTGAGAATTGATTTAACGGACTGGGAAGGAAATCATGCACATTCCCAGTATGACCGGTTTCACATAGGAAATGAAAAGCAGAACTACAGATTATACTTAAAGGGCCACAGTGGGACAGCGGGGAAGCAAAGCAGTCTAATCTTGCATGGTGCAGACTTCAGTACAAAAGATGCAGACAATGACAACTGTATGTGCAAGTGCGCTCTCATGCTGACGGGAGGTTGGTGGTTTGACGCATGTGGTCCTTCAAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACTTCAAAGGGCCCAGTTACTCCCTACGTGCAACAACAATGATGATCCGTCCATTGGATTTCTAATTCTTCAAGAACCAGACAATGTTCATTTGCGAAGGTTCTAAAGTCAGTTCTGATTTCAGCATCAAATGACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATCTGCAAACTCTTTATTCTGAAACCATCATAAATCACGATACAAGATTAATATTCATTCTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTAATAAGCTGTAGTAGATGTGTATACGGCAGTAAGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCAGATGAGTACCATTTGTGATACCCTTGTTTTAACAATACACAGCTATTAAATGATTCTTTCACACAATGTTAAAGTTTGTTTTTCACACATTAAATTAAGA
                                                  Xt7.1-CHK-1008234071                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTGGGGTTTGGAAGCCCATCTGGTGAATTTTGGCTGGGGAATGAGTTTATTTTCGCACTAACCAGCCAAAGGCAGTATTCTCTGAGAATTGATTTAACGGACTGGGAAGGAAATCATGCACATTCCCAGTATGACCGGTTTCACATAGGAAATGAAAAGCAGAACTACAGATTATACTTAAAGGGCCACAGTGGGACAGCGGGGAAGCAAAGCAGTCTAATCTTGCATGGTGCAGACTTCAGTACAAAAGATGCAGACAATGACAACTGTATGTGCAAGTGCGCTCTCATGCTGACGGGAGGTTGGTGGTTTGACGCATGTGGTCCTTCAAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACTTCAAAGGGCCCAGTTACTCCCTACGTGCAACAACAATGATGATCCGTCCATTGGATTTCTAATTCTTCAAGAACCAGACAATGTTCATTTGCGAAGGTTCTAAAGTCAGTTCTGATTTCAGCATCAAATGACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATCTGCAAACTCTTTATTCTGAAACCATCATAAATCACGATACAAGATTAATATTCATTCTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTAATAAGCTGTAGTAGATGTGTATACGGCAGTAAGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCAGATGAGTACCATTTGTGATACCCxTxxTTTAACAATACACAGCTATTAAATGxxTxxTTCACACAATGTTAAAGTTTGTTTTTCACACATTAAATTAAGATTTATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     7     5     7     5     7     6     7     5     7     5     7     6     7     6     7     5     6     5     6     4     6     5     6     5     6     5     6     4     6     5     6     4     6     5     6     5     6     5     7     5     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     8     9     8     9     8     9     7     8     7     8     7     8     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     5     6     3     6     4     7     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     3     5     3     5     2     4     2     4     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-009     NP_504743.2 T15B7.1 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Cs ---- 6e-024     BAB88674.1 fibrinogen-like protein [Ciona savignyi] -------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 8e-025     FAA00181.1 TPA: transcription factor protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Br ---- 1e-030     ABF83551.1 fibrinogen [Branchiostoma belcheri tsingtaunese] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 5e-029     XP_785073.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 9e-033     NP_001015310.1 CG40109-PA.3 [Drosophila melanogaster] -----------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 9e-039     AAI35403.1 Unknown (protein for MGC:121524) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-070     NP_571888.1 angiopoietin 1 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 7e-088     XP_418382.2 PREDICTED: similar to KIAA0003 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-087     NP_033770.2 angiopoietin 1; Angiopoietin-1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-087     NP_001137.2 angiopoietin 1 isoform a [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 3e-092     AAH73367.1 MGC80788 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 3e-092     NP_001085803.1 MGC80788 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA004c16.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------ATGATG------------------TAA------------------ATG---------------------------------------------TGA------------------------------------------ATG------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------ATG------------------TAA---TAA---------TGA---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TGA------------------------------------------------------TAATAA---------------------------------------------ATG------------------------------ATG---ATG---------------------------------TGA---------------------------------------------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Lun1      in                         CABD2627.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAAAGGAATCTTTGCAAAATCTAGTGTCCCGCCAGATTTACATCATCCAGGAGCTGGAGAAGCAGCTGAATAAGGCAACAAACAACAACAGCATCTTGCAGAAACAGCAGCTGGAGCTCATGGAGACGGTGCACAACCTCGTTAAACTCTGTTCCAAGGAAGGAGTAACCTTAAAGAATGTGAAAAAGGAAGAGGAGAAGCCATTTAGAGACTGTTCGGATCTGTTCCATGCTGGATTTAACAAGAGCGGCGTATACACTATTTACATCAATAATGTATCCGAACCTAAAAAGGTTTACTGCAACATGGACACGGCAGGTGGAGGCTGGACAGTAATTCAGCACAGAGAAGATGGGAGTGTCGATTTTCAGAGAGGCTGGAAAGATTACAAAGTGGGGTTTGGAAGCCCATCTGGTGAATTTTGGCTGGGGAATGAGTTTATTTTCGCACTAACCAGCCAAAGGCAGTATTCTCTGAGAATTGATTTAACGGACTGGGAAGGAAATCATGCACATTCCCAGTATGACCGGTTTCACATAGGAAATGAAAAGCAGAACTACAGATTATACTTAAAGGGCCACAGTGGGACAGCGGGGAAGCAAAGCAGTCTAATCTTGCATGGTGCAGACTTCAGTACAAAAGATGCAGACAATGACAACTGTATGTGCAAGTGTGCTCTCATGCTGACGGGAGGTTGGTGGTTTGACGCATGTGGTCCTTNCAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACT
  5   1   2       bld TbA                            TTbA057j12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGATTACTACGTGGGGTTTGGATGCCCGTCTGGTGAATTTTGATTGGGGAATGATTTTATTTTCCCACTAGCCAGCCTTAGGCAGTATTCTCTGAGAATTGATTTATCGGACTGGGAAGGAAATCATGCGCATTCCCAGTATGTACCGGTTTCTCTCTATGAAATGAATCGCATAACTACAGATTATACTTAATGGGCTCGACATATAGCGGACAGCGGGGAACCCAACCTCTCTAATCTTGCGTGGAGCAGACTTCTGTACCATACGATGCACGACCATGACAACTGTATGTGCAAGTGCGCTCTCATGCTGACGGGAGGTTGGTGGTTAGACGCCTGTGGTCCTTCTCATCTGAACGGGATGTACTACTCCGCACGACATATTCTCTGATGGCTGAGTGGAATGACGTGTCGTTACTTCATCGGACCCAGTTACTCCCTACATGCATGAACCATGATGATCCGTCCATTGAATTTCTAATTCTTCTATAGCCTCACCATGTTCATTTGCGAATGTTCTCTCCTCCTTTCTGATTTCGGCATCAAATGACTGATTGTCTTAATCCTATAACCATTTGTTTCCTACTCTCTCATGAATTTCATTGACT
  5   1   2       bld TpA                            TTpA036a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGATTACAAAGTGGGGTTTGGAAGCCCATCTGGTGAATTTTGGCTGGGGAATGAGTTTATTTTCGCACTAACCAGCCAAAGGCAGTATTCTCTGAGAATTGATTTAACGGACTGGGAAGGAAATCATGCACATTCCCAGTATGACCGGTTTCACATAGGAAATGAAAAGCAGAACTACAGATTATACTTAAAGGGCCACAGTGGGACAGCGGGGAAGCAAAGCAGTCTAATCTTGCATGGTGCAGACTTCAGTACAAAAGATGCAGACAATGACAACTGTATGTGCAAGTGCGCTCTCATGCTGACGGGAGGTTGGTGGTTTGACGCATGTGGTCCTTCAAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACTTCAAAGGGCCCAGTTACTCCCTACGTGCAACAACAATGATGATCCGTCCATTGGATTTCTAATTCTTCAAGAACCAGACAATGTTCATTTGCGAAGGTTCTAAAGTCAGTTCTGATTTCAGCATCAAATGACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCANGCGGGACGTTTTTAATAACGAACTATGTAGATATGAAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTG
  5   1   2       bld TbA                            TTbA057j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGATTACAAGTGGGGTTTGGAAGCCCATCTGGTGAATTTTGGCTGGGGAATGAGTTTATTTTCGCACTAACCAGCCAAAGGCAGTATTCTCTGAGAATTGATTTAACGGACTGGGAAGGAAATCATGCACATTCCCAGTATGACCGAGTTTCACATAGGAAATGAAAAGCAGAACTACAGATTATACTTAAAGGGCCACAGTGGGACAGCGGGGAAGCAAAGCAGTCTAATCTTGCATGGTGCAGACTTCAGTACAAAAGATGCAGACAATGACAACTGTATGTGCAAGTGCGCTCTCATGCTGACGGGAGGTTGGTGGTTTGACGCATGTGGTCCTTCAAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACTTCAAAGGGCCCAGTTACTCCCTACGTGCAACAACAATGATGATCCGTCCATTGGATTTCTAATTCTTCAAGAACCAGACAATGTTCATTTGCGAAGGTTCTAAAGTCAGTTCTGATTTCAGCATCAAATGACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTTAATATCAGTTTGATGCAGCTCC
  5   1   2       bld TbA                            TTbA057j09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGATTACAAGTGGGGTTTGGAAGCCCATCTGGTGAATTTTGGCTGGGGAATGAGTTTATTTTCGCACTAACCAGCCAAAGGCAGTATTCTCTGAGAATTGATTTAACGGACTGGGAAGGAAATCATGCACATTCCCAGTATGACCGGTTTCACATAGGAAATGAAAAGCAGAACTACAGATTATACTTAAAGGGCCACAGTGGGACAGCGGGGAAGCAAAGCAGTCTAATCTTGCATGGTGCAGACTTCAGTACAAAAGATGCAGACAATGACAACTGTATGTGCAAGTGCGCTCTCATGCTGACGGGAGGTTGGTGGTTTGACGCATGTGGTCCTTCAAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACTTCAAAGGGCCCAGTTACTCCCTACGTGCAACAACAATGATGATCCGTCCATTGGATTTCTAATTCTTCAAGAACCAGACAATGTTCATTTGCGAAGGTTCTAAAGTCAGTTCTGATTTCAGCATCAAATGACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAGACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTA
  5  -1   2       chi AbdN                               IMAGE:7025438                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAGAATGGGTGGTACCCCTTTCAAAAAATTTAGGAAACGAGGGGAAAGGTTTTTTTACCCCCCGGGGGGGACAGGAAATTACCCGGGAAAAGGTTGAGATTTGGAATAAAAAGGGGGCGTATTTACCTTGCAAAAGGGCCCCCCGGTTTCCTCCCCTGCGGTGGAAACCAACCAATGAATGGTCCCGTCCCATGTGGATTTTATAATTCGTTCAAGGAACCAGGACAATGTTTCATTTGGGAAAGGTTCTAAAGTTCGGTTCTGGATTTCAGGCATCAAATGATTGATTGGCAGAAACCATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCATGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCAAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTCCGCAGACCGTGTCTCAAGTTTCAAATTGCATAACACGCTGTTTCCTGCTCCGTACTCTGTCCCTTCGTGCTGATAGCAAAGGTTACTTTCCGTCCGTCCCGTACTCCACAAACGACCACGTGACTACTTCCAATCAATCACGCTGTCCTGTCTCTCCTGTGTGAGAGGAATGCG
  5   1   2      seed TbA       in                   TTbA004c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGGTTGGTGGTTTGACGCATGGTGGTCCTTCAAATCTGAACGGGATGTACTACACCGCGGGGCAGAATCACGGAAAGCTGAATGGAATAAAGTGGCATTACTTCAAAGGGCCCAGTTACTCCCTACGTGCAACAACAATGATGATCCGTCCATTGGATTTCTAATTCTTCAAGAACCAGACAATGTTCATTTGCGAAGGTTCTAAAGTCAGTTCTGATTTCAGCATCAAATGACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATCTGCAAACTCTTTATTCTGAAACCATCATAAATCACGATACAAGATTAATATTCATTCTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTA
  3   1   2       bld Lun1      in                         CABD2627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTGATTGGCAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTGGAACAAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATCTGCAAACTCTTTATTCTGAAACCATCATAAATCACGATACAAGATTAATATTCATTCTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTAATAAGCTGTAGTAGATGTGTATACGGCAGTAAGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCAGATGAGTACCATTTGTGATACCCTTGTTTAACAATACACAGCTATTAAATGTATTCTTTCACACAATGTTAAAGTTTGTTTTTCACACATTAAATTAAGATTTATTTTTGTT
  5   1   2       bld Gas7      in                         XZG59196.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAACATAGAAACATTTGTTTCCTACTCTCAGATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACATAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATCTGCAAACTCTTTATTCTGAAACCATCATAAATCACGATACAAGATTAATATTCATTCTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTAATAAGCTGTAGTAGATGTGTATACGGCAGTAAGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCAGATGAGTACCATTTGTGATACCCTTGTTTAACAATACACAGCTATTAAATGTATTCTTT
  3   1   2       bld TbA       in                    TTbA004c16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGAATTTCATTGACTTGGAACAAGGCATCAATATATGTTATTTCAAAAAAAACTTAATACAACAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTTTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTTTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATTTGCAAACTCTTTATTTTGAAACCATCATAAATCACGATACAAGATTAATATTCATTTTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTAATAAGCTGTAGTAGATGTGTATACGGCAGTAAGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCAGATGAGTACCATTTGTGATACTCCTTGTTTAACAATACACAGCTATTAAATGTATTCTTTCAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Gas7      in                         XZG59196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAACAATGTTCTCAAGAACTTCACATTTTCATCAGCAGAACGTGAAGACAAATAAACTGCCCGATTTGCATTGTTACCACGGAAACAAACGTTTCCGATTTCTCCTGATGACAATATCAGCGGGACGTTTTTAATAACGAACTATGTAGATATGAATATAGTAGTTACAAAGTAATATTAAATATCAGTTTGATGCAGCTCCCGAGAGAGCCTCTTCATCAGAAGACCCAAAGGTTTGTTTAAAAGCCATTTTGTTTGAAGATTATTCTTGTATTCAGCCATATTTTCTTCAGCAACCACAGCCTGTCAACCATTCAGAAATCATTATTTCTTCGTTCTTGGTTCAATCGAAAGTTTCCATGTTTTTTTTCCGCAGACCTTCATTATTGAAGTTACAAATTATATTGAGCACAAAAACATCTGCAAACTCTTTATTCTGAAACCATCATAAATCACGATACAAGATTAATATTCATTCTACTATTCAAATATGAAATGGTTATGTAAAAGGAAAAAAACATTGTACTGAATACATAGCCACGTGCATTTAATAAGCTGTAGTAGATGTGTATACGGCAGTAAGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCAGATGAGTACCATTTGTGATACCCTTGTTTAACAATACACAGCTATTAAATGTATTCTTTCACCCAAAAAAAAAAGAAAAAAAAAAAAAAATAAAAG
  5   1   2       bld HdA       out                  THdA053g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGTACTGAATACATATCCACGTGCATTTAGTAGACTGTAGTATATGTGTATACGGCAGTCCGTACATTTTCACTTAGTATGTTACTCATATATATACTTTTTGCCGGAGCAATGTATATGAAGTATAATGTGCGAGCCGATGAGTACCATTTGTGATACCCTTGTTTAACAATACACAGCTATTAAATGTATTCTTTCACACAATGTTAAAGTTTGTTTTTCACACATTAAATTAAGATTTATTTTTGTTATCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)