Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSU1391.3                           14 END     5          71       35                lamin A/C [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012086625 Xt7.1-CBSU785.5 - 7 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CBSU785.5               AGGAAAGCAGATCCCTGCGCACTGACAGCCCCCCGTGTATTCGCCAAGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTTCTAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACATGAGGGGCAGGTCGGCCTCTACAAGGAAGAGCTGGAGAAGACCTACAATGCCAAGCT
                                                  Xt7.1-CHK-1008238864                     GCAGATCCCTGCGCACTGACAGCCCCCCGTGTATTCGCCAAGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTTCTAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACATGAGGGGCAGGTCGGCCTCTACAAGGAAGAGCTGGAGAAGACCTACAATGCCAAGCTGGAGAA
                                                      consensus depths                    2     2     2     2     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2
                                               BLH ATG      52     885               
                                               BLH MIN      49     117               
                                               BLH OVR      52     278               
                                               CDS MIN      52       3               
                                               EST CLI      -5       3               
                                               ORF LNG      52      11               
                                                                                                                                                  PROTEIN --- Bf ---- 4e-025     CAA11447.1 intermediate filament protein B1 [Branchiostoma floridae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PROTEIN --- Ce ---- 5e-030     NP_492371.1 nuclear LaMiN (64.1 kD) (lmn-1) [Caenorhabditis elegans] --------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Ci ==== 2e-044     CAC13105.1 nuclear lamin [Ciona intestinalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN --- Sp ---- 2e-052     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Dm ---- 2e-053     NP_523742.2 CG10119-PA [Drosophila melanogaster] -------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Br ---- 1e-062     CAC13104.1 nuclear lamin [Branchiostoma lanceolatum] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN === ?? ==== 2e-085     NP_001081547.1 lamin L(I) [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Dr ==== 2e-110     NP_694503.1 lamin A [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Hs ==== 1e-117     NP_005563.1 lamin A/C [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Mm ==== 5e-118     NP_001002011.1 lamin A isoform A; lamin A/C [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Gg ==== 1e-120     NP_990618.1 lamin A [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Xl ==== 2e-135     CAA29652.1 unnamed protein product [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Xt ==== 7e-144     CAJ83897.1 lamin A/C [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CBSU785.5                                     TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------ATG------ATG
                                                                   ORF                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ...
  0   1   1           Gas  FL                     TGas003c15.FL-Sanger                    AGCAGATCCCTGCGCACTGACAGCCCCCCGTGTATTCGCCAAGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTTCTAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACACGAGGGGCAGGTCGGCCTCTACAAGGAAGAGCTGGAGAAGACCTACAATGCCAAGCTGGAGAATGCCAAGCAGTCGGCCGAGAGGAACAGCAGCCTGGTGGGAGAAGCCCAGGAGGAGATTCAGCAGAGCCGGATCCGCATCGACAGTCTCTCTGCCCAGCTCAGCCAACTGCAGAAACAGCTGGCGGCTAAAGAGGCCAAACTACGGGATCTGGAGGACGCCTACGCCCGCGAACGGGACTCCAACCGGCGCCTCATGTCGGACAAGGACCGGGAGATGGCGGAGATGCGGGCCCGTATGCAGCAGCAGCTGGACGAGTACCAGGAACTGCTGGACATCAAACTGGCGCTGGACATGGAGATCCATGCCTACCGCAAACTACTGGAGGGAGAGGAGGAGAGGCTGCGTCTCTCCCCCAGTCCTACCACTCAGAAGAGGTCGGCAAGGACCGTCGCCTCCCACTCTGGGACCCACATCTCCTCCTCTGCCTCCAAGAGGCGGCGCCTAGAGGCCGGGGAGTCGGGGAGCACCAGTTACACCCAACACGCCCGCACCACCGGGAAGGTCTCCGTGGAAGAGGTGGATCCGGAGGGGAAATACGTGCGGCTGCGGAACAAGAGTAACGAGGACCAATCGCTGGGGAACTGGCAGATCAAGCGCCAGATAGGGGAGGAGACCCCCATTGTGTACAGGTTCCCCCCCAGACTTACACTAAAGGCCGGACAAACGGTGACGATCTGGGCATCAGGCGCCGGAGCCACAAATAACCCCCCCACTGATTTAGTATGGAAGGCCCAGAGCTCCTGGGGAACAGGCGACAGTATTCGCACCGCGCTGCTCACGTCTAACAATGAGGAGGTTGCTATGAGGAAACTGGTGCGCACTGTCGTCATCAATGATGAAGATGGAGATGATGAAGATGATGACGATGTGGGACATCACCACCACCACCACCATCATCATCATCATGATGGGCAGAATAGCGGGGACCCCGGGGAGTACAATCTGCGCTCTCGCACCATCGTTTGCACCAGCTGTGGGCGCCCGGCTGAGAAGGGGGTTCTAGGCTCCCAGGGTTCTGGTTTGGCCACGGCCTCGACCGGTTCCTCATCCTCCAGCGTCACCCTGACCCGGACCTACCGCAGCACCGGGGGAACCAGCGGGGGCAGTGCCCTCGGGGAGAGTCTGGTCACCAGGACCTACATTGTCGGGAACGACAGCCAGCGTGCCCAGGTCACCCCGCAGAGCTGCAGCATAATGTAATCCGCTGCCCGACGCCGCCGTCACCAAGTGCCCAAGTGCCCGAGCGAAACAGAGAGATTTTGGTTTTTTTATGAAAATTTTGTTTTTATTTTATACTGCGAGAATTTTATAAAAAAAAAAAAAAAAAA
  5   1   2   10 seed Limb PIPE out                        CBSU785.fwd .........GGAGAAGGAAAGCAGATCCCTGCGCACTGACAGCCCCCCGTGTATTCGCCAAGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTTCTAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACATGAGGGGCAGGTCGG
  5   1   2   10  bld Limb 5g3  out                       CBSU1391.fwd ..............AGGAAAGCAGATCCCTGCGCACTGACAGCCCCCCGTGTATTCGCCAAGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTTCTAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACACGAGGGGCAGGTCG
  5   1   2       bld Gas  FL                        TGas003c15.p1kSP6                            CCTGCGCACTGACAGCCCCCCGTGTATTCGCCAAGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTG
  5   1   2       bld Gas  5g                        TGas012o04.p1kSP6                            CCTGCGCACTGACAGCCCCCCGTGTCTTCCCCAACAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATNGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAAGAGAGCCATCTGCTGACGGCGCCAGCCCCGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGA
  5   1   2   10  bld Limb 5g3  out                       CBSU5302.fwd ............................................................AGAGCCATGGAGACCCCCGGGCAGAAGCGGGCGACCCGCAGCACCCACACCCCACTCTCCCCCACCCGAATCAACCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCCGCAGCTGG
  5   1   2       bld Limb      out                       CBSU7314.fwd                                                                                                                               CGCATCACCCGCCTGCAGGAGAAGGAAGACCTGCAGGAACTCAACGACCGATTGGCCGTCTACATCGACAAGGTGCGCTCCTTGGAGTCGGAGAACGCCGGGCTGCGCCTGCGCATCACTGAGTCCGAAGAGGTGGTCAGTCGCGAGGTGTCGGGCATCAAGGGGGCCTACGAGGCGGAACTGGCGGACGCCCGCAAAACTCTCGACTCGGTGGCCAAGGAGAGGGCTCGCCTGCAGCTGGAGCTCAGCAAGATCCGCGAGGAGCACAAGGAGCTGAAAGCGAGGAACGCCAAGAAGGAGAGCGATCTGCTGACGGCGCAGGCGCGGCTGAAGGATTTGGAGGCCCTGCTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGAGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTTCTAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACATGAGGGGCAGGTCGGCCTCTACAAGGAAGAGCTGGAGAAGACCTACAATGCCAAGCTGGAGAATGCTCAGCAGTCNGC
  5   1   2       bld TpA       out                  TTpA026a10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGCGATCTGTTGACGGCACAGGCGCGGCTGAAGGATTTGGAGGCCCTGTTGAACTCTAAAGATGCCGCCCTCACCACGGCGCTGGGAGAGAAGCGGAATCTGGAGAACGAGATCAGGGAACTTAAGGCTCACATTGCAAAGTTGGAGGCCAGCCTCGCCGACACAAAGAAACAACTGCAGGACGAGATGCTCCGCCGCGTGGATACCGAGAACCGCAACCAGACGCTGAAGGAGGAGCTTGAGTTCCAGAAGAACATTACCAACGAGGAGATGCGCGAGACCAAGCGCCGCCACGAGACCCGGATGGTGGAGATGGACAACGGGCGGCAGAGGGAGTTTGAGTCCAAACTGGCGGACGCCCTGCAGGATCTCCGTGCCCAACATGAGGGGCAGGTCGGCCTCTACAAGGAAGAGCTGGAGAAGACCTACAATGCCAAGCTGGAGAATGCCAAGCAGTCGGCCGAGAGGAACAGCAGCCTGGTGGGAGAAGCCCAGGAGGAGATTCAGCAGAGCCGGATCCGCATCGACAGTCTCTCTGCCCAGCTCAGCCAACTGCAGAAACAGCTGGCGGCTAAAGAGGCCAAACTTCGGGATCTGGAGGATGCCTACGCCCGCGAACGGGACTCCAACCGGCGCCTCATGTCGGACAAGGACCGGGAGATGGCGGAGATGCGGGCCCGTATGCAGCAGCAGCTGGACGAGTACCAGGAACTGCTGGACATCAAACTGGCGCTGGACATGGAGATCCATGCCTACCGCAAACTACTGGAGGGAGAGGAANGAAGAGGCTGCGTCTCTCCCCCAGTCCTACCACTCAGAAGAGGTCGGCAAGGACCGTCGCCTCCCACTCCGGGACCCACATCTCCTCCTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)