Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABG4287.3                           25 END     6          60       24                PREDICTED: similar to TCDD-inducible poly(ADP-ribose) polymerase [Gallus gallus]

 This cluster: approximate FL confidence score = 94%

 1012086650 Xt7.1-CABJ5314.5 - 10 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ5314.5                 AGGGAGCAGCAGGCGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGAACGCATGCTTCCGGAAGGAAATCAAACGCAGGCCCTTGTTCCGATCGTCTGTGATACTTCTGCCACATCTCCAAACACTCAGTGGAATATCTCCCGT
                                                  Xt7.1-CHK-1008235818                       CAGCAGGCGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGAACGCATGCTTCCGGAAGGAAATCAAACGCAGGCCCTTGTTCCGATCGTCTGTGATACTTCTGCCACATCTCCAAACACTCAGTGGAATATC
                                                      consensus depths                      2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     7     6     7     6     7     7     7     7     7     6     7     6     7     6     8     7     8     7     8     7     8     7     8     7     8     6     8     6     7     5     6     4     5     4     5     4     5     4     6     4     6     4     6     4     6     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     3     4     2     4     3     4     3     4     3     4     3     4     2     3     2     3
                                               BLH ATG     145     301                 
                                               BLH MIN     157      54                 
                                               BLH MPR     157      54                 
                                               BLH OVR     145      97                 
                                               CDS MIN     145      54                 
                                               ORF LNG     145      21                 
                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 4e-012     AAH84660.1 LOC495238 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 4e-012     NP_001088385.1 hypothetical protein LOC495238 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 1e-094     NP_001038484.1 hypothetical protein LOC563506 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 8e-118     NP_849223.2 expressed sequence AW558171 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 6e-121     NP_056323.2 TCDD-inducible poly(ADP-ribose) polymerase [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 4e-143     XP_422828.1 PREDICTED: similar to TCDD-inducible poly(ADP-ribose) polymerase [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ5314.5                                                                                                                                                                  ATG------------------ATG---------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG
                                                                   ORF                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ...
  0   1   1           Brn4 FL                          CAAL9202.FL-MGC                           AGGCGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGAACGCATGCTTCCGGAAGGAAATCAAACGCAGGCCCTTGTTCCGATCGTCTGTGATACTTCTGCCACATCTCCAAACACTCAGTGGAATATCTCCCGTGGCACCTCCAGCAAACCAAGCCGATTCCCTGCAAATCCTGTCTCCTATAGCAATTACTTCTCCCAACTTTTACCCTGAAACATGGCTCTCCATGGACGCATCTCAGGAGTTCTTTCAAGTGCCTATGTCTAAGGAAGACAAAAGCTACAGGACAGTTTATACTCTGTTTCACAAAACGGTGCCAGAAACCAGGTTCCGCATTTTAAAGATAATACGCGTCCAGAATCTCTTCTTGTGGGAAAAATATAAGAGGAAAAAAGAATTCATGACAAGGAAGATGACGGGACTGGACAGAATTATGAATGAAAGGCATCTGTTCCACGGGACCTCGCAGGATGTTGTTGATGCAATTTGCAAACACAACTTTGACCCCAGAGTGTGCGGGAAGCATGCCACCATGTTTGGACAGGGCAGTTACTTTGCCAGGAAAGCCAGCTATTCACACAACTTTTCCAAACGCTCCCCCAAAGGAGTTCACTATATGTTTCTGGCTAAAGTGCTAACTGGAAGGTACGTGGTTGGGAATCATACCATGAGAAGGCCTCCTCCGTTAAACCCAGGGAGCTTGACCAGTGACCTCTATGACTCTTGTGTGGACAACTTCTTTGAGCCCCAGATTTTTGTTATATTTAACGATGATCAGAGCTACCCTTATTTTATTATCCAGTATGAAGAAGTTAGCAACACTGTCTCCATTTAACAACATGAAAGCTGCTTTAATGTCTCTTAGGATCTGTTATTTAAATTGGTGGGAAAAGAAAGAGACTGAAAAATAAATCTACTAGTCGTGATGGACATACAACGACCAACAGTGCACTTGCCGCTAATTATGTGCATTTTGTAAATACATTTTTCAATGTTAATAGTTTGTGTGCCTTTGTTAATAAAATCTTTATTTAATGAGTAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 5g3  out                        XZG32771.5p GGGAAGCTTGTCACGTAGGGAGCAGCAGGCGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCANGGTTATTCCCAGGATATGGCTCTCTGGACCAATACAGTTTAACCAAAACAATCCAAC
  5   1   2       bld Tbd0 5g                            IMAGE:6980687     GAACTTGTCCGTAGGGAGCAGCAGGCGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAGATCCTCTCCTGCAGACAAATCTCACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGNTTATTCCCAGGATATGGCTCN
  5   1   2       bld Brn4 FL   out                        CAAL9202.5p                           AGGCGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTT
  5   1   2   10  bld Ski1 5g3  out                        CABJ1223.5p .............................CGAGAGCGGGCTAGGATCCCTCCCTCCTCCCTCTGGAACAGAGGCTCAGCCAGGGGACAAGGAACCTTACTCCAGCCTAACCCCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCAAGTCTTA
  5   1   2       bld Gas1 5g                            IMAGE:6989138                                                                                                                CCGGAACTGGCACAACCTCCTTGCAGGCTTGTCTGAGGCATTTTGAACCCATGGAGAACTCTATACAAATTATGGATACAGCGCCTCATGGGGAATGTTCTGTGAAGGTCCCTTGTTCTGACATAAGTGGCAAAGACATGAGTCAAAGGGACTTTTCTATGCACTCCAACAAAATTCCACCACTGAAGCCATGTTTTAAAAAGAAACAGGCTCCGAAATTATTAGACTCAGAAACAATAAATGCTCTAAGGCCAATAATTACTAGTTTTTTGGGATCTGGGACTCTCGATGAAATATTTGTGTCTAGGAATCGAGCAGGGAATACGAGCAGTTTATGTGAGCCCATCGACAAAAAGGCACTGGGGATGGAGCAGCAGTGTCCTCCAACTAATTCACTGATATCTGGGAGTCCAAGTCTTAGCCCCTTAACAGACCAACCACCTACCGTTCATGCAGAGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACAATACAGTTTAACCAAAACATTCCAACGCTGGAAATTTCAGGACAAACAGAAGGGCATCTCTACTTCTTGTGTCGACTTTTGATCAGTTGCATATCATGTCCACCAAAAGA
  5   1   2      seed Ski1      out                        CABJ5314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAGGAAGACCTTGTGGTACATCAGCCCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGAACGCATGCTTCCGGAAAGGAAATCAACGCAGGCCCTTGTTCCGATCGTCTGTGATACTTCTGCCACATCTCCAAA
  5   1   2       bld Eye       out                        CCAX5954.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGCACTGTATTAGACACAACGGAACCAACATTTCCATCAGACAATTCAAATATGACTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGGCCTAAAAAGGTACGCTTTGTTACATGGCAC
  5   1   2       bld In63                            IMAGE:8959018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTTTTGCCGGATTCCATCTTAATTTTAATTCGTCCCCTGTTAATAATAATACTGCCAATGGCTCTTTCCAAGATCCTCTCCTGCAGACAATCTCAACAGATTTCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGACGCATGCTTCCGGAAGGAAATCAACGCAGCCCTTGTTCCGATCGTCTGTGATACTCTGCACATCTCAACACTCGTGATATCTCCGTGCACTCAGCAACAGCGATCCCTGCATCTGTCTCTATAGCATACTCTCCACTTTTACCCTGAAACATGG
  5   1   2   10  bld Ski1 5g3  out                        CABJ4429.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCAATTCGGCACGAGGCACCAATCCTGGCTGCTTAGACAAGATAACAGAAAGCTACTCATCAGGGTTATTCCAGGATAATGGCTCTCTGGACCAATACAGTTTAAACCAAAACAATTCCAACGCTGGAATATTTCAGGACAAAACAGAAGAGGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAGATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGAACGCATGCTTCCGGAAGGAAATCAAACGCAGGCCCTTGTTCCGATCGTCTGTGATACTTCTGCCACATCTCCAAACACTCAGTGGAATATCTCCCGTGGCACCTCCAGCAAACCAAGCCGATTCCCTGCAAATCCTGTCTCCTATAGCAATTACTTCTCCCCACTTTTACCCTGAAACATGGCTCT
  5   1   2       bld Gas                            TGas021c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACAAAACAGAAGAGCATCTCTACTTCTTGTGTTCGAACTTTTGAATCAGTTGCAATATCATGTCCACCAAAAAATGGGGTGGACATATGTGTGGATTTCCTACAGGGTTTGTGCTTGTATGGAAACGACTGTCAGAAACATCACACGGTATTGCCATATCATTGGCAGGTTAGGAGGAGAGCTACCAGCATATGGCAGAGTGTGAACGATGATTCTCAAGAACATGTGGAAAGGCTCTACTGCAGCCCAGATAGCGACCGAATCAAAATGAGATATCAGGGACATGATTTTCTAGTAGACTTGAACTGTATGGAGATTTATGAGTCTCTTGAATTTGACCAAATCCGACGACTGTCAACACCAACTACCTCTGGCGTGTCCTCTAATTATCACACTGTGTGGAAGTACTTCTGCCGAGATCATTTCGGGTGGAGGGAGTATTCTGAGCCTGTCGTGAAGCTCATAGAAGAGGCCAACTGCCGGGGCCTAAAAGAGGTACGCTTTGTTACATGGCACAACCAGTACATACTGAATATAAAGGATGGATTTCAGCAGAACGCATGCTTGCGGAAGGAAATCAAACGCAGGCCCTTGTTCCGATCGTCTGTGATACTTCTGCCACATCTGCAAACACTCAGTGGAATATCTCCCGTGGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)