Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-ANBT2188.3                           15 END     1           7        6                MGC131159 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 181.0    0Xt7.1-TGas143d10.3                        145 PI      71        671     1431                transcription factor 7-like 1 (T-cell specific, HMG-box) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012086811 Xt7.1-CABK3485.3 - 13 ESTs
                                                                       ....-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK3485.3                                                                                                                                                                                                   CCCCTCTCCCCCCCACATTGCAGGAGCCGGGAGCGGCCAGGGGAGGAAGGGAAACTTTTTTTGTCGGAGGGGGGAATCTTGGGGCTGAGTCTGGGAGTTGCAGTGCGACAGAGTAGCAGGGGCAGAGATGCCGCAGTTGAACGGCGGTGGGGGGGACGATCTGGGGGCCAACGATGAAATGATCTCCTTTAAGGATGAGGGGGAACAGGAGGAGAAAATCTCCGAGATCAGCTCGGCCGAGCGGGACCTGGCGGATGTCAAGTCGTCTCTTGTCAATGAGTCTGAGACCCCCCAGAACAGCTCGTCCGACTCTGAGGCGGAGCGGCGCCCCCCTCCCCGGTCCGAGAGTTTCCGGGACAAGAGCCGGGACAGCCTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGCAGACAAGGACTCAAGGACACCAGGTCTCCGTCCCCGGCTCACATTGTTTCTAACAAAGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGATCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCGGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCCAAAAAAGAAGAAGAAAAGAAAAAGCCGCACATAAAGAAACCTCTAAACGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCCTTATCCAGGGAAGAGCAAGCGAAATACTATGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTGTACCCCGGATGGTCGGCTCGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCTAATGAACACAGCGAGTGTTACCTAAATCCTTGCCTTTCTCTTCCTCCGATCACAGACCTGAGCGCTCCTAAGAAATGTCGAGCGCGCTTTGGCCTTGATCAGCAGAATAACTGGTGCGGTCCCTGCAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACCGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCTTTTTATTTTTTTTTTTCCATGAATTTCACCACGTTCTTCATTTGTGCCAAACGGCTCCTTTTCATTGGTTAGTAGGTGTTTTTCACGAAGCTCATTGGTCAATATTTGACCTCTTCCTTCACTTCTCCGATGTGAGTCGCCGACCTCAACGAAACCTCCGCAATTCTGCCAAAATTTCATCCGCTGTCA
                                                  Xt7.1-CHK-1008233638                                                                                                                                                                                                         TCCCCCCCACATTGCAGGAGCCGGGAGCGGCCAGGGGAGGAAGGGAAACTTTTTTTGTCGGAGGGGGGAATCTTGGGGCTGAGTCTGGGAGTTGCAGTGCGACAGAGTAGCAGGGGCAGAGATGCCGCAGTTGAACGGCGGTGGGGGGGACGATCTGGGGGCCAACGATGAAATGATCTCCTTTAAGGATGAGGGGGAACAGGAGGAGAAAATCTCCGAGATCAGCTCGGCCGAGCGGGACCTGGCGGATGTCAAGTCGTCTCTTGTCAATGAGTCTGAGACCCCCCAGAACAGCTCGTCCGACTCTGAGGCGGAGCGGCGCCCCCCTCCCCGGTCCGAGAGTTTCCGGGACAAGAGCCGGGACAGCCTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGCAGACAAGGACTCAAGGACACCAGGTCTCCGTCCCCGGCTCACATTGTTTCTAACAAAGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGATCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCGGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCCAAAAAAGAAGAAGAAAAGAAAAAGCCGCACATAAAGAAACCTCTAAACGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCCTTATCCAGGGAAGAGCAAGCGAAATACTATGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTGTACCCCGGATGGTCGGCTCGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCTAATGAACACAGCGAGTGTTACCTAAATCCTTGCCTTTCTCTTCCTCCGATCACAGACCTGAGCGCTCCTAAGAAATGTCGAGCGCGCTTTGGCCTTGATCAGCAGAATAACTGGTGCGGTCCCTGCAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACCGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCTTTTTATTTTTTTTTTTCCATGAATTTCACCACGTTCTTCATTTGTGCCAAACGGCTCCTTTTCATTGGTTAGTAGGTGTTTTTCACGAAGCTCATTGGTCAATATTTGACCTCTTCCTTCACTTCTCCGATGTGAGTCGCCGACCTCAACGAAACCTCCGCAATTCTGCCAAAATTTCATCCG
                                                      consensus depths                                                                                                                                                                                                        2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     6     5     6     3     6     3     6     5     7     3     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     7     8     7     8     7     8     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     6     7     6     7     7     7     7     7     7     7     5     7     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5
                                               BLH ATG     127     537                                                                                                                                                                                                   
                                               BLH MIN     127     268                                                                                                                                                                                                   
                                               BLH MPR     127     268                                                                                                                                                                                                   
                                               BLH OVR     127     294                                                                                                                                                                                                   
                                               CDS MIN     127     268                                                                                                                                                                                                   
                                               ORF LNG     127      32                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Sc ---- 5e-007     NP_015390.1 The ROX1 gene encodes a heme-induced repressor of hypoxic genes in yeast.; Rox1p[Saccharomyces cerevisiae] =============================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bb ---- 6e-013     ABD24303.1 Sry-like protein C [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 2e-033     NP_491053.3 POsterior Pharynx defect family member (pop-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Ci ==== 9e-055     BAE06722.1 transcription factor protein [Ciona intestinalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Cs ==== 8e-072     BAB68354.1 Cs-tcf [Ciona savignyi] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 1e-072     NP_726522.1 pangolin CG17964-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Sp ==== 4e-092     NP_999640.1 HMG protein Tcf/Lef [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Bf ==== 4e-112     AAZ77711.1 transcription factor protein Tcf [Branchiostoma floridae] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 0          AAI36074.1 Unknown (protein for IMAGE:7657171) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 0          NP_033359.2 transcription factor 7-like 2, T-cell specific, HMG-box; transcription factor7-like 2 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 0          NP_571334.1 transcription factor tcf4 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAK58836.1 T-cell factor XTCF-4A [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 0          NP_001083866.1 T-cell factor XTCF-4A [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 0          NP_110383.1 transcription factor 7-like 2 (T-cell specific, HMG-box) [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 0          XP_421760.2 PREDICTED: similar to TCF7L2 [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK3485.3                                                                                                                                                                                                                                                                                        TGA---------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------TGA------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           Brn3 FLt3                        CAAK6311.FL-MGC GTCGGACTGAGCCGCGGATTTGGGGGCCGCGCATTTTGCTCTTTTTCTCTCTTTATTTTTGGCTTCTTGTTGTTGTTGAATCTGGCGGAGTGCGGAGCCGGGAGGTGGGGGCCCCGCTAACCGGACTGGCACAGCCCCCCCTTTCCCTCCCAGCCCCCCCACCGGCAGCACAAAGCAGGGGGACAGCCCGGGGCCCCCTCTCCCCCCCACATTGCAGGAGCCGGGAGCGGCCAGGGGAGGAAGGGAAACTTTTTTTGTCGGAGGGGGGAATCTTGGGGCTGAGTCTGGGAGTTGCAGTGCGACAGAGTAGCAGGGGCAGAGATGCCGCAGTTGAACGGCGGTGGGGGGGACGATCTGGGGGCCAACGATGAAATGATCTCCTTTAAGGATGAGGGGGAACAGGAGGAGAAAATCTCCGAGATCAGCTCGGCCGAGCGGGACCTGGCGGATGTCAAGTCGTCTCTTGTCAATGAGTCTGAGACCCCCCAGAACAGCTCGTCCGACTCTGAGGCGGAGCGGCGCCCCCCTCCCCGGTCCGAGAGTTTCCGGGACAAGAGCCGGGACAGCCTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGCAGACAAGGACTCAAGGACACCAGGTCTCCGTCCCCGGCTCACATTGTTTCTAACAAAGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGATCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCGGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCCAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FLt3 in                         CAAK6311.5p  TCGGACTGAGCCGCGGATTTGGGGGCCGCGCATTTTGCTCTTTTTCTCTCTTTATTTTTGGCTTCTTGTTGTTGTTGAATCTGGCGGAGTGCGGAGCCGGGAGGTGGGGGCCCCGCTAACCGGACTGGCACAGCCCCCCCTTTCCCTCCCAGCCCCCCCACCGGCAGCACAAAGCAGGGGGACAGCCCGGGGCCCCCTCTCCCCCCCACATTGCAGGAGCCGGGAGCGGCCAGGGGAGGAAGGGAAACTTTTTTTGTCGGAGGGGGGAATCTTGGGGCTGAGTCTGGGAGTTGCAGTGCGACAGAGTAGCAGGGGCAGAGATGCCGCAGTTGAACGGCGGTGGGGGGGACGATCTGGGGGCCAACGATGAAATGATCTCCTTTAAGGATGAGGGGGAACAGGAGGAGAAAATCTCCGAGATCAGCTCGGCCGAGCGGGACCTGGCGGATGTCAAGTCGTCTCTTGTCAATGAGTCTGAGACCCCCCAGAACAGCTCGTCCGACTCTGAGGCGGAGCGGCGCCCCCCTCCCCGGTCCGAGAGTTTCCGGGACAAGAGCCGGGACAGCCTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGC
  5   1   2       bld Spl2      in                        CBSS5098.fwd                                                                                                                                                                                       GCAGCCCGGGGCCCCCTCTCCCCCCCACATTGCAGGAGCCGGGAGCGGCCAGGGGAGGAAGGGAAACTTTTTTTGTCGGAGGGGGGAATCTTGGGGCTGAGTCTGGGAGTTGCAGTGCGACAGAGTAGCAGGGGCAGAGATGCCGCAGTTGAACGGCGGTGGGGGGGACGATCTGGGGGCCAACGATGAAATGATCTCCTTTAAGGATGAGGGGGAACAGGAGGAGAAAATCTCCGAGATCAGCTCGGCCGAGCGGGACCTGGCGGATGTCAAGTCGTCTCTTGTCAATGAGTCTGAGACCCCCCAGAACAGCTCGTCCGACTCTGAGGCGGAGCGGCGCCCCCCTCCCCGGTCCGAGAGTTTCCGGGACAAGAGCCGGGACAGCCTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGCAGACAAGGACTCAAGGACACCAGGTCTCCGTCCCCGGCTCACATTGTTTCTAACAAAGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGG
  3   1   2      skin Brn3 FLt3 in                         CAAK6311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCGAGAGTTTCCGGGACAAGAGCCGGGACAGCCTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGCAGACAAGGACTCAAGGACACCAGGTCTCCGTCCCCGGCTCACATTGTTTCTAACAAAGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGATCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCGGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCC
  3   1   2       bld Spl2      in                        CBSS5098.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACAGCNTGGAGGACGCTGCCAAAAGGCCCGACGGAGGGCTGTTTAAGGGCCCGGCATATGGAGGTTACCCCTTCATCATGATCCCCGACCTGACCAGCCCCTACTTGCCCAACGGATCTCTCTCTCCCACTGCCCGAACGTGCGTGAATGTACCACTAGATCTGCATTTAGCCTCTTGTTGCAGCCCTTTCATGCAGTATCTGCAGATGAAATGGCCCCTCCTGGATGTCCAGGCTGGAAGTTTACAGAGCAGACAAGGACTCAAGGACACCAGGTCTCCGTCCCCGGCTCACATTGTTTCTAACAAAGTGCCCGTTGTACAGCACCCTCACCATGTCCACCCCCTCACGCCGCTCATTACCTACAGCAACGAGCACTTTACCCCAGGGAACCCCCCACCGCACTTACAGGCAGACGTGGATCCAAAAACAGGAATCCCAAGGCCTCCACACCCTCCGGACATTTCCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCC
  5   1   2      skin Eye       in                         CCAX5993.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGTATTACCCTTTATCCCCGGGCGCCGTCGGACAGATCCCCCATCCGCTAGGATGGTTAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGCTTCCTTTCCTCTAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCCAAAAAAGAAGAAGAAAAGAAAAAGCCGCACATAAAGAAACCTCTAAACGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCCTTATCCAGGGAAGAGCAAGCGAAATACTATGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTGTACCCCGGATGGTCGGCTCGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCTAATGAACACAGCGAGTGTTACCTAAATCCTTGCCTTTCTCTTCCTCCGATCACAGACCTGAGCGCTCCTAAGAAATGTCGAGCGCGCTTTGGCCTTGATCAGCAGAATAACTGGTGCGGTCCCTGCAGAAGGAAAAAGAAGTGCATTC
  5   1   2       chi Int1      in                         CAAP7733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTACCACAGCAAGGTCAGCCCGTTTACCCAATCACGACAGGGGGCTTCCGGCACCCCTACCCCACCGCCCTTACCGTCAATGCTTCCATGTCAAGATTCCCGCCCCACATGGTGCCGCCCCATCACAGTTTGCACACAACTGGAATCCCTCACCCCGCCATCGTCACCCCCACCGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCAGGATTCCAAAAAAGAAGAAGAAAAGAAAAAGCCGCACATAAAGAAACCTCTAAACGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCCTTATCCAGGGAAGAGCAAGCGAAATACTATGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTGTACCCCGGATGGTCGGCTCGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCTAATGATACCAATGCGCCTAAGAAGTGTCGGGCATTGTTTGGACTTGACAGACAGAATTTATGGTGTAAACCATGCAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGC
  5   1   2       bld Spl1      in                         CABK3485.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGATTCGGTCAAACAGGAGTCTTCCCAGAGCGACATGGGATCCCTCCATAGCTCGAAACATCANGGATTCCAAAAAAGAAGAAGAAAAGAAAAAGCCGCACATAAAGAAACCTCTAAACGCGTTCATGCTGTATATGAAGGAGATGAGGGCAAAAGTCGTGGCCGAGTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCCTTATCCAGGGAAGAGCAAGCGAAATACTATGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTGTACCCCGGATGGTCGGCTCGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCTAATGAACACAGCGAGTGTTACCTAAATCCTTGCCTTTCTCTTCCTCCGATCACAGACCTGAGCGCTCCTAAGAAATGTCGAGCGCGCTTTGGCCTTGATCAGCAGAATAACTGGTGCGGTCCCTGCAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAA
  5   1   2       chi Tad0      in                     NISC_no09g03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGCACGTTAAAAGAAAGCGCAGCCATCAATCAGATCCTTGGCCGAAGGTGGCACGCCTTATCCAGGGAAGAGCAAGCGAAATACTATGAGCTGGCGAGGAAGGAGAGGCAACTCCACATGCAGCTGTACCCCGGATGGTCGGCTCGGGATAACTATGGCAAGAAGAAGAAGAGGAAAAGGGAAAAGCAACAAGGAGAGGCTAATGAACACAGCGAGTGTTACCTAAATCCTTGCCTTTCTCTTCCTCCGATCACAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACGCTCAT
  3   1   2      seed Spl1      in                         CABK3485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAAGGGAAAAGCACNAAGGAGAGGCTAATGAACACAGCGAGTGTTACCTAAATCCTTGCCTTTCTCTTCCTCCGATCACAGACCTGAGCGCTCCTAAGAAATGTCGAGCGCGCTTTGGCCTTGATCAGCAGAATAACTGGTGCGGTCCCTGCAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACCGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCTTTTTATTTTTTTTTTTCCATGAATTTCACCACGTTCTTCATTTGTGCCAAACGGCTCCTTTTCATTGGTTAGTAGGTGTTTTTCACGAAGCTCATTGGTCAATATTTGACCTCTTCCTTCACTTCTCCGATGTGAGTCGCCGACCTCAACGAAACCTCCGCAATTCTGCCAAAATTTCATCCGCTGTCACGTTC
  3   1   2       bld Int1      in                         CAAP7733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGCAACAAGGAGAGGCTAATGATACCAATGCGCNTAAGAAGTGTCGGGCATGTTTTGGACTTGACAGACAGAATTTATGGTGTAAACCATGCAGAAGGAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACCGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCTTTTTATTTTTTTTTTTCCATGAATTTCACCACGTTCTTCATTTGTGCCAAACGGCTCCTTTTCATTGGTTAGTAGGTGTTTTTCACGAAGCTCATTGGTCAATATTTGACCTCTTCCTTCACTTCTCCGACGTGAGTCGCCGACCTCAACGAAACCTCCGCAATTCTGCCAAAATTTCATCCGCTGTCACGTTCAAAA
  3   1   2       bld Eye       in                         CCAX5993.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAATAACTGGTGCGGTCCCTGCAGAAGGAAAAAAGAAGTGCATTCGCTACATACAAGGTGAAGGCAGCTGCGTTAGCCCGCCCTCTTCAGATGGAAGCTTATTAGACTCCCCTCCTTCCTCTCCCGCCATGCCCGACTCCCCCGCATCGGACTCCAAACCACAAACTGAACAAACGCAACCTCTCTCTTTATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTTTTTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACCGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCTTTATTTTTTTTTTTTTCCATGAATTTCACCACGTTCTTCATTTGTGCCAAACGGCTCCTTTTCATTGGTTAGTAGGTGTTTTTCACGAAGCTCATTGGTCAATATTTGACCTCTTCCTTCACTTCTCCGATGTGAGTCGCCGACCTCAACGAAACCTCCGCAATTCTGCCAAAATTTCATCCGCTGTCACGTTC
  5  -1   2       bld HdA       out                 THdA036l20.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACAAACGCAACCTCTGTCTTTATCCGTGAAGCCAGACTCGCTGGCGCGGATGTGAGTGCCGCATTCGCCTATGGCCCAGAGCCCCGCGCGGAAGCCCATGCGATCATGCCGGTCTCCATTTGCCAGAACGGAGCAGAACACGGTCATCCGCACAATGTTCTGCAGTAGTCTTTGCCATAGGGCCTGTCGCTCACACAACGGTCCACCTCCTTTTTGCCCTCCCACCGGTCATTGGCAGGAATGACGCAAGTTCAGCCCTTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCCTTTTATTTTTTTTTTTCCATGAATTTCACCACGTTTTTCATTTGTGCCAAACGGCTCATTTTCATTGGTTAGTAGGTGTTTTTCACGAAGTTCATTTGTCAATATTTGACCTCTTCCTTCACTTCTTCGATGTGAGTCGCCGACATCAACGAAACCTACGCAATTATGCCAAAATTTCATCCGCTGTCACGTT
  3   1   2       bld Tad0      in                     NISC_no09g03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCTTGAAGCCCGACCCGCTGGCGCGGATCTGCGTGCCGCATTCGCCTCTGGCCCAGAGCCCCGCGCGGAAGCCCAGCGCTCTGCCGGTCACCATTTGCCAGAACGGAGCAGAACACGCTCATCCGCACAACGTTCTGCAGTCGTCTCTGCCCTACGGCCTGTCGCTCACACAACCGTCCACCTCCTTTCTGCCCTCCCACCGCTCATTGGCCGGAACGACGCAACTTCAGCCCCTGTCCCTCGTCACCAAACCTTTAGAGTAGAACCACATTTCCTCCATCTTCATCTTATTTTTTTTTAAAGATTTCTGGGTCCTTTTTATTTTTTTTTTTCCATGAATTTCACCACGTTCTTCATTTGTGCCAAACGGCTCCTTTTCATTGGTTAGTAGGTGTTTTTCACGAAGCTCATTGGTCAATATTTGACCTCTTCCTTCACTTCTCCGATGTGAGTCGCCGACCTCAACGAAACCTCCGCAATTCTGCCAAAATTTCATCCGCTGTCACGTTCAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)