Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Feb 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-st44h19.3                             7 END     1          10       14                PREDICTED: similar to beta-1,3-galactosyltransferase 6 [Strongylocentrotus purpuratus]

 This cluster: approximate FL confidence score = 92%

 1012086943 Xt7.1-XZT48787.5 - 10 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     4     5     5     5     5     5     4     5     5     5     5     5     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3
                                               BLH ATG     100     751                                                                                                                                                                                           
                                               BLH MIN     100     136                                                                                                                                                                                           
                                               EST CLI     -48       1                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 1e-007     AAM18882.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                                                                                    PROTEIN --- Ce ---- 6e-068     NP_505958.1 C.Elegans Homeobox, sine oculis SIX3 homolog, required for head morphogenesis (49.6 kD) (ceh-32) [Caenorhabditis elegans] ---------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-087     NP_524695.2 CG18455-PA, isoform A [Drosophila melanogaster] --============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                    PROTEIN --- Ci ---- 6e-093     BAE06688.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                  PREDICTED - Sp ---- 2e-102     XP_781696.1 PREDICTED: similar to Homeobox protein SIX6 (Sine oculis homeobox homolog 6) (Optic homeobox 2) (Homeodomain protein OPTX2) [Strongylocentrotus purpuratus] -----================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 2e-128     NP_001018421.1 hypothetical protein LOC553611 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 2e-129     NP_031400.1 sine oculis homeobox homolog 6; optic homeobox 2 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 3e-130     NP_035514.1 sine oculis-related homeobox 6 homolog [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 2e-131     NP_990325.1 OPTX2 protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 4e-140     AAD47356.1 homeobox protein Optx2 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 8e-141     AAI35853.1 Unknown (protein for MGC:122113) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 8e-141     NP_001093696.1 SIX homeobox 6 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT48787.5                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---ATG------------------------------------------TAA---------------------------TAA---------------------------------------------------TGA------------------TAG---------------------------------------TAA---------------------------------TGA---------------------------ATG------------------------ATG------------------------------------------------------------------------------TAG------------------------------TGA------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  3   1   2       bld TpA  5g3  in                    TTpA042o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAACAGAAGACTCTCTGCTTTAAAGAACGAGGGAGGCATTTGTTTAGGGAATGGTACTTACAAGATCTTTATCCAAATCCCAGCAAAAAAAGGGAATTCGCCCAAGCGACTGGACTTACCCCAACACATGTAGGGAATTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGATAAGAACAGGCAGCAGCAGCAAGTTTTGTCCCAGGGAACTGTCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGGTGGGCTCAGCTTCCAGTCCAGCAGCAAGTCTGTCCAGCAAAGCGGCCACTTATGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTAAGCGCAGCAAAAACTTACAACACAGTGCCTGAATAAGGGTAACAGCCTGGGCCACAGGACCTTTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATT
  3   1   2       bld HeRe 5g3  in                     EC2CAA19CC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTCATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATTCACAATAGAAGACTGTAAGGTTTGCCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGAGCGGCCGCTCTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTTGTAGACGCATGTGCGCCAAATCTACGG
  3   1   2       bld HeRe 5g3  in                     EC2CAA31CE11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATCCACAATAGAAGACTGTAAGGTTTGTCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGAGCGGCCGCTCTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTGTAGACGCATGTGCGCCAAATCTATGGATCTAATCAAGAAGTAAAATA
  5   1   2       bld Tad5      out                        XZT22998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTTGTAGACGCATGTGCGCCAAATCTATGGATCTAATCAAGAAGTTAAATAAAATATGTAATGAGCAACTTATTATTATTATTACTAAAGTTATGTTCTGCATGGGTATTTGTTCAATGGGTGGGTGCTTTAAACCATTTTAGTACTTCATCACAAAGCTCATAGCTGGAAAGGGTTACCCGCCATGATATATACAAAAAGTTTTACTCTTACACCCCTTTCCTTTTAACAACAACTCCCACGGAATTAAAAGCACAGCGGTTCTTGGTGGCCACATCCTGGTAAATATATAACAGTAGCTGAACTGAGTTTGTTAGAACTATTGATACATAGGTAGAATTGTGCAAAAGCTAAAATGTTGTGACTAAAATTTGGGGCCATATATTTATGCAATCGAGACATTTCATATAGTCCCAGATAATGGTTGAACAGTATCTTTCTATTTGTAACCAGAGATTTGTTACATAGACAATTGTTTAGTGAGGTTTAATGTTGGTTTTTGCGTTATGGTATTTTGGGAATACACATAATTGTCTCAACCATGAAACCACCATAACGT

In case of problems mail me! (