Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-st44h19.3                             7 END     1          10       14                PREDICTED: similar to beta-1,3-galactosyltransferase 6 [Strongylocentrotus purpuratus]

 This cluster: approximate FL confidence score = 92%

 1012086943 Xt7.1-XZT48787.5 - 10 ESTs
                                                                       ......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT48787.5                                                                                                                                                                                           CAGCCAGAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCAAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGCACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATTCACAATAGAAGACTGTAAGGTTTGTCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGAGCGGCCGCTCTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTTGTAGACGCATGTGCGC
                                                  Xt7.1-CHK-1008236515                                                                                                                                                                                                 GAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCAAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGCACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATTCACAATAGAAGACTGTAAGGTTTGTCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGAGCGGCCGCTCTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTTGTAGACGCATGTGCGCCAAATC
                                                      consensus depths                                                                                                                                                                                                4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     4     5     5     5     5     5     4     5     5     5     5     5     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3
                                               BLH ATG     100     751                                                                                                                                                                                           
                                               BLH MIN     100     136                                                                                                                                                                                           
                                               EST CLI     -48       1                                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 1e-007     AAM18882.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                                                                                    PROTEIN --- Ce ---- 6e-068     NP_505958.1 C.Elegans Homeobox, sine oculis SIX3 homolog, required for head morphogenesis (49.6 kD) (ceh-32) [Caenorhabditis elegans] ---------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-087     NP_524695.2 CG18455-PA, isoform A [Drosophila melanogaster] --============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                    PROTEIN --- Ci ---- 6e-093     BAE06688.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                  PREDICTED - Sp ---- 2e-102     XP_781696.1 PREDICTED: similar to Homeobox protein SIX6 (Sine oculis homeobox homolog 6) (Optic homeobox 2) (Homeodomain protein OPTX2) [Strongylocentrotus purpuratus] -----================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 2e-128     NP_001018421.1 hypothetical protein LOC553611 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 2e-129     NP_031400.1 sine oculis homeobox homolog 6; optic homeobox 2 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 3e-130     NP_035514.1 sine oculis-related homeobox 6 homolog [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 2e-131     NP_990325.1 OPTX2 protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 4e-140     AAD47356.1 homeobox protein Optx2 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 8e-141     AAI35853.1 Unknown (protein for MGC:122113) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 8e-141     NP_001093696.1 SIX homeobox 6 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT48787.5                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---ATG------------------------------------------TAA---------------------------TAA---------------------------------------------------TGA------------------TAG---------------------------------------TAA---------------------------------TGA---------------------------ATG------------------------ATG------------------------------------------------------------------------------TAG------------------------------TGA------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           Tad5 FL                          XZT48787.FL-MGC                                                                                                                                                                                    GCGAGTGCAGCCAGAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCGAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGTACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATTCACAATAGAAGACTGTAAGGTTTGTCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGA
  5   1   2       add Gas8 5g3  out                         st76p12.5p TGTTTCGGTGCTGCACTCAGTGTGCATGGAAAGGGCGCTAGGATGAGGCCGCTGGCACTGCGCTGAGTGACTGTCCCGCTGCTGCTGCTGCTGCCGCTGTCGCTGCCGTTAGTGCCGCTGCTTCTTTCTCCCTGGCTCCTGCGGTCCCCCCCCTGCCGGCCATCCCATGGTGTTCAGGTCTCCTCTAGAGCTTTATCCCGCCCACTTCTTCCTGCCCAACTTCCCTGANCGCTCAGTGCTCCTGGCCGGCTCCANCGGGGGCCCCCGGGCCCAAGAAGAACTGTCAATGTTCCAGCTGCCGAGCCTGAACTTTTCCCCGGAGCAAGTGGCCAGCGTGTGTGAGACGCTGGAGGAGACGGGGGACATAGAGAGGCTGGGGCGCTTCCTGTGGTCCCTGCCCGTGGCCCCCGGGGCGTGTGAGGCCATCAATAAGCATGAGTCCATCCTGCGGGCCCGGGCCGTGGTCGCCTTCCACACCGGCAACTTCAGGGACCTCTACCATATCCTGGAGAATCACAAGTTCACCAAGGAGTCCCACGGGAAGCTGCAGGCCATGTGGCTGGAGGCGCATTACCAGGAGGCGGAGAAGCTCCGGGGGCGCCCCCTGGGGCCGGTGGATAAGTACCGGGTAC
  5   1   2       bld HeRe 5g3  in                     EC2CAA31CE11.g1                                                                                                                                           GACAGCCGCAGCGATACCTTTGCTTGGCTGTTGGAGTTACAGCGAGTGCAGCCAGAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCAAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGCACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTA
  5   1   2      seed TpA  5g3  in                   TTpA042o24.p1kSP6                                                                                                                                                                                 TACGCGAGTGCAGCCAGAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCGAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGCACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACAC
  5   1   2       bld Tad5 FL                              XZT48787.5p                                                                                                                                                                                    GCGAGTGCAGCCAGAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCGAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGTACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCANAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACCACACAGTGCCTGACTAAACGTA
  5   1   2       bld HeRe 5g3  in                     EC2CAA19CC09.g1                                                                                                                                                                                     GGAGTGCAGCCAGAGATCATCTTCAAGTAGGTCGAGCTCACATCTTGTCATCTTTTTATGCGGAGTCGACGTTCAAAAAGCTGATTTGGCAACAAAATCAGAGTCAATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAGGTAGCTGGGGTGTGTGAGACCCTAGAAGAGAGTGGGGACATTGAGCGCCTTGGTCGCTTTCTGTGGTCATTGCCAGTAGCTCCTGCAGCCTGTGAGGCACTTAATAAAAATGAGTCTGTCCTCCGAGCTAGGGCTATTGTGGCCTTTCATACGGGGAACTTCAGGGAACTCTACCACATTCTGGAAAATCACAAATTTACCAAGGACTCGCACACCAAGCTGCAGGCTCTGTGGCTGGAGGCGCATTACCAAGAAGCAGAGAAGCTAAGGGGGAGACCTTTGGGGCCAGTAGATAAGTACAGAGTGAGAAAGAAGTTCCCTCTCCCCAGAACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACGAGGCATTTGCTTAGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAA
  3   1   2       bld Tbd1      out                        CBXT1948.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCTACAGTATTGAGGAGAAAGGGCGTACAACTGGTTACAATGTGTGTGCGCTATATAGAATTAAAGCCTACTTAGCCCCCTAGCGAGCTGCATTCCATTAAATTCCATTAAAGGTAGTACACGGTTTGCTTGTAAACCAAACAATGGAAGGGCGAATGGAAGAGTCTGTTCCATCGTATGTAACTGCAGTGCCCACGATTGCACACTTCTGTATGTTGTCCTTTGAAACGGTTAAATAAAGAGCTTCTAGTGCTTGTTAGCCCTGTGTGTTTGCATGGCCGAGTGAGCATGACTGTCTGTATATTTGTGTGTGCGTATTTGTGTTTGCGTGTATATGTTCCTGCCCGTTGCATTAGTGGTAGTTGGTGCATGTATTGTAGTTATCGCTCAGTGACCCTCTCCTGTTGTATTTTGTCAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTTCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATTCACAATAGAAGACTGTAAGGTTTGTCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGA
  3   1   2       bld TpA  5g3  in                    TTpA042o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAACAGAAGACTCTCTGCTTTAAAGAACGAGGGAGGCATTTGTTTAGGGAATGGTACTTACAAGATCTTTATCCAAATCCCAGCAAAAAAAGGGAATTCGCCCAAGCGACTGGACTTACCCCAACACATGTAGGGAATTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGATAAGAACAGGCAGCAGCAGCAAGTTTTGTCCCAGGGAACTGTCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGGTGGGCTCAGCTTCCAGTCCAGCAGCAAGTCTGTCCAGCAAAGCGGCCACTTATGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTAAGCGCAGCAAAAACTTACAACACAGTGCCTGAATAAGGGTAACAGCCTGGGCCACAGGACCTTTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATT
  3   1   2       bld HeRe 5g3  in                     EC2CAA19CC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGAATGGTACCTACAAGATCCCTATCCAAATCCCAGCAAAAAAAGGGAACTCGCCCAAGCGACTGGACTTACCCCAACACAAGTAGGGAACTGGTTCAAAAACCGGAGACAAAGAGACAGAGCAGCGGCGGCTAAGAACAGGCTGCAGCAGCAAGTCTTGTCCCAGGGAACTGGCCATTCATTGGGTCCGGATGAGAGAGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTCATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATTCACAATAGAAGACTGTAAGGTTTGCCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGAGCGGCCGCTCTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTTGTAGACGCATGTGCGCCAAATCTACGG
  3   1   2       bld HeRe 5g3  in                     EC2CAA31CE11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGAGAACCGCTGGGCTCAGCCTCCAGTCCTGCAGCAAGTCTGTCCAGCAAAGCGGCCACCTCTGCCATCTCCATCACATCCAGCGACAGTGAATGTGACATCTGACCCATGGGCACACTTAGCGCAGCACAAACTCACAACACAGTGCCTGACTAAGCGTTACAGCCTGGGCCACAGGACCATTAACAGGCCGTCTCAGTACCAGGGTTCGCTTATCACATTGGCATTTCTGACTACTGATCTGCCTGCAATCCACAATAGAAGACTGTAAGGTTTGTCACACTTAATCTGGGGACCTACTAATCCAATGCCTCGATTGCCTACTCTCCAAGTGTCTGAGCGGCCGCTCTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTGTAGACGCATGTGCGCCAAATCTATGGATCTAATCAAGAAGTAAAATA
  5   1   2       bld Tad5      out                        XZT22998.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCAAACTATCTGAGCGCATGCCCTTTTCATTCTATGGCTATTTCATGGTGGAAAAAAAAGACTTTTTTTACTTTAACGTTTGTTTTTATATATTATATAATGACTTATTTAAGGGTTTGCAACTGTAGACTTCTTTTGCTTGTCTGTATGTGCGCAGGTGATTTTGTAGACGCATGTGCGCCAAATCTATGGATCTAATCAAGAAGTTAAATAAAATATGTAATGAGCAACTTATTATTATTATTACTAAAGTTATGTTCTGCATGGGTATTTGTTCAATGGGTGGGTGCTTTAAACCATTTTAGTACTTCATCACAAAGCTCATAGCTGGAAAGGGTTACCCGCCATGATATATACAAAAAGTTTTACTCTTACACCCCTTTCCTTTTAACAACAACTCCCACGGAATTAAAAGCACAGCGGTTCTTGGTGGCCACATCCTGGTAAATATATAACAGTAGCTGAACTGAGTTTGTTAGAACTATTGATACATAGGTAGAATTGTGCAAAAGCTAAAATGTTGTGACTAAAATTTGGGGCCATATATTTATGCAATCGAGACATTTCATATAGTCCCAGATAATGGTTGAACAGTATCTTTCTATTTGTAACCAGAGATTTGTTACATAGACAATTGTTTAGTGAGGTTTAATGTTGGTTTTTGCGTTATGGTATTTTGGGAATACACATAATTGTCTCAACCATGAAACCACCATAACGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)