Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  28.0    0(repeat)                                    0 REP     90          1      561                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012087155 Xt7.1-st25l05.5 - 8 ESTs
                                                                       ........-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-st25l05.5                                                                                                                       GAGGTTTTGTAGTTACAATGGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGGGGGGGG
                                                  Xt7.1-CHK-1008237746                                                                                                                             TTGTAGTTACAATGGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGG
                                                      consensus depths                                                                                                                            3     3     3     3     7     7     8     8     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     5     7     8     8     7     8     8     8     8     8     8     8     8     8     8     8     6     7     8     8     8     8     8     8     6     7     5     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     5     5     5     5     4     4
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                       -----T------
                                               BLH ATG      17     377                                                                                                                       
                                               BLH OVR      17      39                                                                                                                       
                                               EST CLI      17      19                                                                                                                       
                                               ORF LNG      17       1                                                                                                                       
                                                                                                                                                                                                                                                           PROTEIN === Ci ==== 4e-054     AAQ96276.1 H3L-like histone [Ciona intestinalis] =================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN === Br ==== 8e-058     AAR91665.1 histone H3 [Branchiostoma lanceolatum] ======================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN === Sc ==== 6e-064     NP_009564.1 Histone H3 (HHT1 and HHT2 code for identical proteins); Hht1p [Saccharomycescerevisiae] =====================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PREDICTED = Ce ==== 1e-069     NP_502134.1 predicted CDS, histone (his-45) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PREDICTED = Sp ==== 9e-071     XP_786147.1 PREDICTED: similar to CG31613-PA [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN === Xl ==== 3e-071     AAA49765.1 histone H3 [Xenopus laevis]  =================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN === Xt ==== 3e-071     CAJ82338.1 histone 2, H3c [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PREDICTED = ?? ==== 3e-071     XP_706665.1 PREDICTED: similar to CG31613-PA isoform 2 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PROTEIN === Dm ==== 2e-071     NP_724345.1 CG31613-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                              PREDICTED = Gg ==== 2e-071     XP_001231209.1 PREDICTED: hypothetical protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Mm ---- 2e-071     NP_835734.1 histone 2, H3ca1 [Mus musculus] ---------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PREDICTED - Hs ---- 8e-072     XP_497711.2 PREDICTED: similar to H3 histone, family 2 isoform 2 [Homo sapiens] ---------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED - Dr ---- 2e-072     XP_693155.1 PREDICTED: similar to CG31613-PA [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-st25l05.5                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                 ]
  3   1   2      skin Gas8 5g3  in                          st25l05.3p                                                                                                                       GAGGTTTTGTAGTTACAATGGCCCGTACCAAGCAAACCGCCCGTAAATNCACCGGAGGGAAAGCTNCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGNGGNGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTTTNCGGGAGATNCGCCGNTACCAGAAATCCACCGAGNTGNTNATNCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGNGNTTCCAGAGNTCAGCCGTCATGGCTTTTCAGGAGGCCAGCGAGGNTTATTTGGTCGGTNTNTTTGAGGACACCAACCTGTGCGCCATNCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATNCGAGGCGAGAGGGCTTAGATNCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCT
  3   1   0       add Gas8 5g3  in                          st41g08.3p                                                                                                                       GAGGTTTTGTAGTTACAATGGCCCGTACCAAGCAAACCGCCCGTAAATNCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTNCCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGNGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTTTNCGGGAGATNCGCCGCTACCAGAAATCCACCGAGCTGCTCATNCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGNTTNCAGAGNTCAGCCGTCATGGCTTTTCAGGAGGCCAGCGAGGCTTATTTGGTCGGTNTNTTTGAGGACACCAACCTGTGCGCCATNCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGNTGGCCCGTAGGATNCGAGGCGAGAGGGNTTAGATNCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCC
  3   1   2      skin Gas8 5g3  in                          st41h08.3p                                                                                                                       GAGGTTTTGTAGTTACAATGGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTNCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGNGGNGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTTTNCGGGAGATNCGCCGNTACCAGAAATCCACCGAGCTGNTCATNCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATNGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTTTTCAGGAGGCCAGCGAGGCTTATTTGGTNGGTNTNTTTGAGGACACCAACCTGTGCGCCATNCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATNCGAGGCGAGAGGGCTTAGATNCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGT
  5   1   2       bld Gas8 5g3  in                          st25l05.5p                                                                                                                                        ATGGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGGGGGGGGTATGTACTAAATATATTAAATATAGAACTTCACAT
  5   1   2       bld Gas8 5x3  out                         st63m07.5p                                                                                                                                        ATGGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGGGGGGGGGGTATGTACTAAATATNTTAAATATAGAACTTCACATTTATTCATTCTTCCCTAAA
  5   1   2      seed Gas8 5g3  in                          st41h08.5p                                                                                                                                         TGGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGGGGGGGGTAT
  5   1   2       bld Gas8 5g3  in                          st41g08.5p                                                                                                                                          GGCCCGTACCAAGCAAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGGG
  5   1   2       bld Gas8      out                         st21o15.5p                                                                                                                                                    GCAGCAACCGCCCGTAAATCCACCGGAGGGAAAGCTCCCCGCAAGCAGTTGGCTACCAAGGCAGCCAGGAAAAGCGCCCCAGCCACCGGCGGCGTCAAGAAGCCTCACAGATACCGGCCCGGCACAGTCGCTCTCCGGGAGATCCGCCGCTACCAGAAATCCACCGAGCTGCTCATCCGCAAGCTGCCTTTCCAGCGCCTGGTCCGGGAGATCGCTCAGGACTTCAAGACCGACCTGCGCTTCCAGAGCTCAGCCGTCATGGCTCTTCAGGAGGCCAGCGAGGCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGCGCCATCCACGCCAAGAGGGTCACCATCATGCCCAAGGACATCCAGCTGGCCCGTAGGATCCGAGGCGAGAGGGCTTAGATCCAACCCGCAGAACCTTCCTCCCCAATAGCACAAAGGCTTTTTTCAGAGCCACCAAATCCCCAATCAAATGGGCTGAACGTCATTTTATTTTTGTGTAAATCCTCCTGTGTATGGGAACTGTGAGGGGGGGGGGGTATGTACTAAATATATTAAATATAGAACTTCACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)