Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT43247.3.5                         28 END     4          57       14                helicase [Xenopus laevis]

 This cluster: approximate FL confidence score = 73%

 1012087261 Xt7.1-IMAGE:6987226.5 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:6987226.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCTCTCTCTCTCTGGTTGGGTTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGTACAATGCTTCATGATATCTTTCAAAGAGCAACAACACGTGGGTTTACTGACAGTGTGCTGCAAGAGCTTGCCCATCACACAGTTCATGGGCCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCAAACTGATGTTATGGGAGAAGTACAAGAATATCTTCCATCCTTCGCTAAGTGGGCAATTGATTTCATGACACATCCTCTCAATCAACACCAGATAAATGTTACCAGACCAACAGCTGGAGACCCCACAGAGGCAACTAAAGTTTCAGAGTT
                                                  Xt7.1-CHK-1008239948                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTCTCTCTGGTTGGGTTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGTACAATGCTTCATGATATCTTTCAAAGAGCAACAACACGTGGGTTTACTGACAGTGTGCTGCAAGAGCTTGCCCATCACACAGTTCATGGGCCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCAAACTGATGTTATGGGAGAAGTACAAGAATATCTTCCATCCTTCGCTAAGTGGGCAATTGATTTCATGACACATCCTCTCAATCAACACCAGATAAATGTTACCAGACCAACAGCTGGAGACCCCACAGAGGCAACTAAAGTTTCAGAGTTTCTAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     2     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3
                                               BLH ATG      40     163                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      40      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 4e-009     NP_012034.1 DNA replication helicase; Dna2p [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-010     XP_797241.2 PREDICTED: similar to helicase [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 6e-013     NP_727386.1 CG2990-PB [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 3e-017     NP_496516.1 yeast DNA helicase/endonuclease family (dna-2) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 2e-054     NP_796346.1 DNA2 DNA replication helicase 2-like [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 1e-057     NP_001006497.1 similar to DNA2-like homolog (DNA replication helicase-like homolog) [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Hs ---- 3e-060     XP_166103.4 PREDICTED: DNA2 DNA replication helicase 2-like [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 2e-137     AAL79550.1 helicase [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 2e-137     NP_001079231.1 helicase [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:6987226.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------ATGATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
  0   1   1           Egg  FL                     TEgg140m04.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGTACAATGCTTCATGATATCTTTCAAAGAGCAACAACACGTGGGTTTACTGACAGTGTGCTGCAAGAGCTTGCCCATCACACAGTTCATGGGCCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCAAACTGATGTTATGGGAGAAGTACAAGAATATCTTCCATCCTTCGCTAAGTGGGCAATTGATTTCATGACACATCCTCTCAATCAACACCAGATAAATGTTACCAGACCAACAGCTGGAGACCCCACAGAGGCAACTAAAGTTTCAGAGTTTCTAGACATTGAGGAAAATATTTGGTCCCCAAGATTTGGTCTAAAGGGCAAAATTGATGTAACTGCTAGGGTAAAAATACACCAGAAGTCCAAATCTCATTTGAAAATTATGCCTCTTGAGCTAAAAACTGGCAAAGAGTCAAACTCAATAGAACACAGGAGTCAGGTTGTTTTGTACACTCTTTTAAGTCAGGAGAGGCGAGAAGATCCAGAAGCTGGTTTACTTTTATATCTAAAGACAGGGAACATGTACTCTGTACCTGGAAATCGACTTGATAGGAGAGAGTTATTAAAAATAAGGAATGAGTTATCCTATTACCTGACAAATGTTGTACATAAATCAGACAATGGAAGTAAAGAAATCACTCTAGCTTCTCTGCCAGCCTTGATTGCTGATAGACAAGCCTGCAAGTTTTGTTCACAGATGCGGAACTGTGCCCTTTATAGCAGATCTGTTGAGCAACAAATTGAGAATTGTTACATTCCTGCTGAAATGATTCCAGTTGTTCAGAAGGAAACAGAACATTTAAATAAGGATCATTTGCAATACTTTAGGCTGTGGTATCTCATGTGCACCTTGGAGGGAAATTCCAAGGACTCAAAAATGGGACGCAAAAATATATGGATGATGTCATCTTCTGAAAGAGAAGAAGATGGCCAGTGCATTGGGAACCTTATTAGGACTGGACCTGTACAAACCATTTCTGATGGGCAACATCTACATTCCTTTCAGCGTAAATCTGGTACTGTGCCTGCAACAAACTTAATGTCAGGTGATAGAGTTGTAGTAAGTGGAGAAGATAAGTTTCTTGCTCTGTCAAGTGGCTACATAAAAGAAGTCAAACATAACAACATCACTTGCATTTTGGACAGGAGTCTTGGCAAGCTTCCTGAGGATTTGTTATTTAGGCTTGATCATGAAGAAGGAGGAGGTGGTTTAGAGTCCCATCTTGGAAACTTATCAAGGCTAATGGAGAACTCACCTGTAAGTGACAAACTGCGGAAACTGATCATCGACTTTAGCAAACCAAATTTTGTTCAACATTTAAGCTCTGTTCTTCCATCTGATGCAAAGGATATTGTTGCTAACATTTTAAAAGGCCTTAACAAACCTCAGAAGCAGGCAATGAAACGTGTTCTTCTTTCTAAAGACTACACTCTTATTGTTGGCATGCCAGGGACTGGGAAAACCACTACAATATGTACCCTGGTGAGAATTTTGTATGCTTGTGGTTACAGTGTCCTGCTAACCAGTTACACACACTCTGCTGTAGATAACATTTTATTGAAGTTAAAAAAATTCCAAGTTGGCTTTCTGCGCTTAGGACGAACACAGAAGCTCCACCCAGATGTTCAGGAATTCAGCGAAGAAGAAATCTGCAAAGCCAAGTCAATAAAATCTTTAAGTGCTTTGGAAGAACTCTACAATAGTCAGCCTGTGGTTGCAACAACATGTATGGGTGTGAATCATCCGATATTTACACGAAGGCGGTTTGACTTTTGCATTGTTGATGAAGCATCCCAAATTAGTCAGCCAATTTGCCTTGGCCCATTGTTCTTTGCCGACAGATTTGTTCTAGTGGGTGACCATCAACAACTTCCTCCACTAGTGCAAAGTGCAGAAGCAAGAGAACTGGGAATGAGTGAGAGCCTTTTTAAACGGCTGGAAAGGAATCAAGAGGCTGTAGTGCAGTTGACTGTGCAATATCGAATGAATAGTCAGATTATGGCACTAAGCAACAAGCTGGTGTATGAAGGCAGGCTGGAGTGTGCCTCTGATCGTGTATCTAACGCTGTGGTTAAGCTACCTCATATTAAGACGTTACTTCTGGAGCTGGAGTTCAGAGAGAGCCAGGAATCAATGTGGATTAAAGATGTATTGGAGCCAAGTAACCCTGTGTGCTTTCTGAATACAGAAAAAATTCCAGCCCTGGAAACTGAAGAGAAGGGTGGAATAAGCAACTGGATAGAAGCTAAATTGGTGTTCTGTTTGACAAAGCTGTTTCTAAAGGCTGGCTGCAGACCCTCAGACATTGGGATCATAGCACCATATCGTCAGCAACTTAAAGTTATCTCTAATTATTTCAACTCCTTGTCAGCGAGTGCCGTGGAAGTGAATACAGTAGATAAATATCAAGGGAGAGACAAAAGTGTCATCATTGTGTCTTTCGTTAGAAGCAATATTGATGGAAAACTGGGAGACCTTTTAAAAGACTGGAGAAGGCTAAATGTGGCGCTGACACGGGCCAAACACAAGCTGATCATGTTGGGCTGCGTTCCAACCCTTAGCCGCTTTCTTTGCCTGGAGCAGCTGATATGTCATCTAAAATCTAAAAATCTAATTTATGATCTTCCAGCCGGCGCCCATGAGCATATGCCTGTATGAAGAGGCCTTTTCTGATGCTGTTAAGAAGCCATTTGTGCTCTCACAGGTGCCTTGTTAGCACTTGGAACGGAGGATGTTCTGGGCACACAATTCTTTTCATTGAACTCATGTTGAACAATTAGGGGAACTTATGTTGAACAATGTAGCAATTGGGGAAATGATGGCTTATTATACAGAGATCATTATTTAAATCTACAGTAGTCAAAGGGGGAGAGTAAGGGCAATGGCACGCAATGAGATATGTTGCTCCAGGAGAGTTTGCCCTACCCGCGGGTAACAGATCACCTAAAAATGCCTTGCCATTCTCACCTTCAGATCTCTGCATGTAAAGCACATTACCCAATCACAATTTAATTGCAGAGAAATGTGGAAGTAAGCATATTCCAGCAATTAACTGGATTGCCACATGTAATCTGTTTTTTAAATGAAGCAATCTGAAGGTTAGTGAATTGCAAGGCATTTTGTGAGAGATTTGTTGCCTGGAGTAGCGCAGGTTTTTCCATGGGTAACAGATCTCCTTGTGTGCCATAGCCCTAAGAGTAATGAGAAAAATATCAATTAGCACTTTGAAGTAAAAGCAGTTTTGTTATTTCAGTTTCTCGTGTTAAATGAGTTCTATTGCCCCTTAATAATTTGCAGGTAGAAGAATTTATATATCAGAAGCTGACTTTGGGAAAGATTTAACAAACTGTATGATTAGAGCTCATTCACCCACTCTATTAATTCCACTGGGATTTTTTTGAAGCATATTTATCAGTGGGTGAAAGTTAGAGTTCACCATTTTATAAATACTCTTTTAAAAACCGATTAGAAATGAATAGAGAGTGGGCACATTTTTCTGTGGTGAGCTCTAATCTCACATTTTGGTAAATCTGCCCCTTAAAGTAGGCTGTGCCTCAGTCCTAAATTTTTTTAGTTTTTTTCTGTAATTGATTTGCATTTACTGTTTAACAAATTAAGGCTTTGCTTTCAGACACAAACCATTTAACCGTAGTTTGTTATATTGCTAGCATTGCTAAACCAGTCTAAATAAGCTTTAATATAGCAGCTCCATATCTGTATAAACACTAGATGGTGCTGTTTTGTTAGCTGTTTAGGCTAATGGCACATGAAGCAGTTTCGGGAATTTTTACCCACCACCCAAAACACAAGAAATCCAAATTACCATGGTGATGGCAGGTGATCAACCTAAAAGATGCAATTCATGAGTACATGGGGCACATTCTCATAATGACCATGTAGAATAAATGTAACTGTTTTACTTTCTTTGAAGAGAGCCCCTGTTAGAGTGGCTGTTTATTGTCATTTGTTTCCTTAGACTGGAACTGAATTGAATAGTAACAGTACAACTACAACTCTATTTTTACATTTCTAACCTATCCGTACCCCCCTTTGGTTACATATGTATCACTTGCTATCTAACTGATAGTGTTTATATGCCATGTTTTGAGCATGTGAGAAGTTTCAGCTGAGGCAAGCATCTGGTGCCTATTATTATATGCAGAGATAAAAGCCCTAGTACCCATAATATTGAGTTTATTACTTATACAGGGTGGAACGGACCAACAAACTGTGAATAGGTTACATTCTCCTCTTATTTTTGTATATACACTTGAAATTAGACTAGTTACATTGTCTATATGAGAATGTAAGGTGTAAGGCATTTAAATTCTGCATATGATCCATTTTTTGCTCTCAGGCTGAATTCACTAATGAAAAAAACACTTGTGACCTCTGCCATATTTCATAAATAGCAATTCCTTTGCATGGGACTGTGACATATACCTCATTGTCTGACTGTTCAAATTGTCAGGCTCCAATTCTAACTGAATCAGACAGGATAAGCTAGAAAATAATCATTTCTTCATGTTGAGATTTTACAATTTTGTACTATTTACATAACAGTTGGTGTAATTTATCTGTTGAATAAAATAATATTTGCTATTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       chi Te3                                  CAAM8459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGGAACTTAGACGCTGCGAGGCACGTTTACTCGGGGTTAATGATCTGGGGATCTTTAGATTTTTCTGAACAAAATGATTTTTCATAAATGAAAAGAAAAAAGTTGTAGTTCTGATAAAGGGAGGCTGTGGATCTCAAGCGCTCACAGGAATTGAGCCCCCATTGCCTAACAAATCCTTCCTCTTAGCCCCTGTGCCCGCCCACAAGCGTCCGAGCAATTTTGTCAGCTTTCAGCTTCCGTATTCCAAACGCGGGACGGATGAAATGGGCGGTGACTGAGTGTCAGACTCAGTACGGTGTTATGTAGCACTTCCACACTTGGTAGCTTGTCTCTCTCTCTCTCTCTCTCTGGTTGGGTTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAGTGAGATATGAATGGAGGGAACTGATGAAGGACAGCGCTAAGGGTGAAGACACACTGAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCANACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCT
  5   1   2   17  bld Te3  5g3  out                       CAAM10030.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTGGAACTTAGACGCTGCGAGGCACGTTTACTCGGGGTTAATGATCTGGGGATCTTTAGATTTTTCTGAACAAAATGATTTTTCATAAATGAAAAGAAAAAAGTTGTAGTTCTGATAAAGGGAGGCTGTGGATCTCAAGCGCTCACAGGAATTGAGCCCCCATTGCCTAACAAATCCTTCCTCTTAGCCCCTGTGCCCGCCCACAAGCGTCCGAGCAATTTTGTCAGCTTTCAGCTTCCGTATTCCAAACGCGGGACGGATGAAATGGGCGGTGACTGAGTGTCAGACTCAGTACGGTGTTATGTAGCACTTCCACACTTGGTAGCTTGTCTCTCTCTCTCTCTCTCTCTGGTTGGGTTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCANACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAG
  5   1   2       bld Gas0 5g3  out                        dad25g02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGAGCACTTCCACACTGGGTAGCTTGTCTCTCTCTCTCTCTCTCTGGTTGGGTTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGT
  5   1   2       bld Gas1 5g                            IMAGE:6987226                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCCCGAGAAGTTCCCGGGGATGTTTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGTACAATGCTTCATGATATCTTTCAAAGAGCAACAACACGTGGGTTTACTGACAGTGTGCTGCAAGAGCTTGCCCATCACACAGTTCATGGGCCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCANACTGATGTTATGGGAGAAGTACAAGAATATCTTCCATCCTTCGCTAAGTGGGCAATTGATTTCATGACACATCCTCTCAATCAACACCAGATAAATGTTACCAGACCACAGCTGGAGACCCACAGAGGCACTAAGGTTTCGGATTTCTAGACATGAGGAAAT
  5   1   2   14  bld Te3  5g3  out                        CAAM1801.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCTCTCTGGTCGGGTTTGTCTTCAGCTTCCAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGTACAATGCTTCATGATATCTTTCAAAGAGCAACAACACGTGGGTTTACTGACAGTGTGCTGCAAGAGCTTGCCCATCACACAGTTCATGGGCCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCAAACTGATGTTATGGGAGAAGTACAAGAATATCTTCCATCCTTCGCTAAGTGGGCAATTGATTTCATGACACATCCTCTCAATCAACACCAGATAAATGTTACCAGACCAACAGCTGGAGACCCCACAGAGGCAACTAAAGTTTCAGAGTTTCTAGAC
  5   1   2      seed Egg  FL                        TEgg140m04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGTCTTCAGCTTCACAATGGAACCCGTGAGTGCTGAGTGTCAGCTGCCCCCGGAGGATGATTTGTTAGAGATGATGATGGAGCAAAGTTTCACTGAGCCGGAAGAGAAGTCTAAAGACAAATCAACCAGAAAAATAATCCCGAAGACTAAGCTCTGCAGAGGCCTCAACAACAGATACTGTGTTCTGAATGTGAAGGAAGTATATGCACAAGGAGAGGAGAAACATCTGACTATTACAGCATCTCAGGAGGGTGATGATCTAGAGCTCTGCATTCTAAAGGATGACTGGGTAGCTCTTCATATCAAACCTGGTGATATAATCCACTTGGAGGGTAACTGTGCTTTTGACAACACATGGACCATAAGCAGAGACACAGGATATCTTATCTTATACCCTGACTTGCTCATATCTGGTACTAGCATAGCAAATGGAATTAGATGTTTAAGGAGATCGGTACTGAGTGAAAAATTCAAGGTCTGTGATAAAGGATCCCGTCAAATGCTTATTGGTACAATGCTTCATGATATCTTTCAAAGAGCAACAACACGTGGGTTTACTGACAGTGTGCTGCAAGAGCTTGCCCATCACACAGTTCATGGGCCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCAAACTGATGTTATGGGAGAAGTACAAG
  5   1   2       bld Te4       out                        CAAN2324.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAAGTATCTAAAAGAAATGTATCAGTTAAAATTAAATCAAACTGATGTTATGGGAGAAGTACAAGAATATCTTCCATCCTTCGCTAAGTGGGCAATTGATTTCATGACACATCCTCTCAATCAACACCAGATAAATGTTACCAGACCAACAGCTGGAGACCCCACAGAGGCAACTAAAGTTTCAGAGTTTCTAGACATTGAGGAAAATATTTGGTCCCCAAGATTTGGTCTAAAGGGCAAAATTGATGTAACTGCTAGGGTAAAAATACACCAGAAGTCCAAATCTCATTTGAAAATTATGCCTCTTGAGCTAAAAACTGGCAAAGAGTCAAACTCAATAGAACACAGGAGTCAGGTTGTTTTGTACACTCTTTTAAGTCAGGAGAGGCGAGAAGATCCAGAAGCTGGTTTACTTTTATATCTAAAGACAGGGAACATGTACTCTGTACCTGGAAATCGACTTGATAGGAGAGAGTTATTAAAAATAAGGAATGAGTTATCCTATTACCTGACAAATGTTGTACATAAATCAGACAATGGAAGTAAAGAAATCACTCTAGCTTCTCTGCCAGCCTTGATTGCTGATAGACAAGCCTGCAAGTTTTGTTCACAGATGCGGAACTGTGCCCTTTATAGCAGATCTGTTGAGCAACAAATTGAGAATTGTTACATTCCTGCTGAAATGATTCCAGTTGTTCAGAAGGAAACAGAACATTTAAATAAGGATCATTTGCAATACTTTAGGCTGTGGTATCTCATGTGCACCTTGGAGGGAAATTCCNAGGACTCAAAAATGGGACGCANAAATATATGGATGATGTCATCTTCTGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)