Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA073o11.3                         10 END     6          66       60                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 339.0    0Xt7.1-CUNH431.3                             9 PI      80        377      800                Indian hedgehog protein precursor (IHH) (Banded hedgehog protein) (X-BHH)

 This cluster: approximate FL confidence score = 98%

 1012087323 Xt7.1-XZT42783.5 - 9 ESTs
                                                                       .........-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT42783.5                                                                                                                                                                                                                                                                                                                                                    GCAGCCCTGCTTGCGCTTATTGCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGATGTAAGGACAAGCTGAACGCCTTGGCGATCTCAGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTCACGGAGGGTTGGGATGAGGATGGGCACCACTCGGAGGAGTCGCTGCATTACGAGGGGAGAGCAGTGGACATTACCACGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGCCAGGCTGGCGGTGGAAGCCGGGTTCGACTGGGTCTATTTTGAGTCCAAGGCTCACATCCACTGCTCGGTCAAAGCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGTGAGAGAGCTGCGCCCCGGGGACCGGGTCCTCTCCTCCGACCCCCAAGGGAATCTCATCTACAGCGATTTCCTCCTGTTCATAGACAAGGAGCATGACGTCAAGAAGCTCTATTACGTCATCCAGACGTCTCAGACCCGAATCCGGATGACGGCGGCCCACCTGCTTTTCGTGGCCCAGAGCAACGGAACCGGGTCTTTCAAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAAGTTGACCTTGAGGAGGACATTGGGGCTTTTGCCCCCGTAACTGCCCAGGGGACTGTGGGTTATAGACGAGGTGTTGGCCTCCTGCTATGCAGTCATTGA
                                                  Xt7.1-CHK-1008237199                                                                                                                                                                                                                                                                                                                                                          CTGCTTGCGCTTATTGCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGATGTAAGGACAAGCTGAACGCCTTGGCGATCTCAGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTCACGGAGGGTTGGGATGAGGATGGGCACCACTCGGAGGAGTCGCTGCATTACGAGGGGAGAGCAGTGGACATTACCACGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGCCAGGCTGGCGGTGGAAGCCGGGTTCGACTGGGTCTATTTTGAGTCCAAGGCTCACATCCACTGCTCGGTCAAAGCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGTGAGAGAGCTGCGCCCCGGGGACCGGGTCCTCTCCTCCGACCCCCAAGGGAATCTCATCTACAGCGATTTCCTCCTGTTCATAGACAAGGAGCATGACGTCAAGAAGCTCTATTACGTCATCCAGACGTCTCAGACCCGAATCCGGATGACGGCGGCCCACCTGCTTTTCGTGGCCCAGAGCAACGGAACCGGGTCTTTCAAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAAGTTGACCTTGAGGAGGACATTGGGGCTTTTGCCCCCGTAACTGCCCAGGGGACTGTGGGTTATAGACGAGGTGTTGGCCTCCTGCTATGCAGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                         2     2     3     3     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     3     5     3     6     3     6     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     2     3     1     3     2     3     2     3     2     3
                                               BLH ATG     249     501                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN     246     153                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     249    1328                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     249      78                                                                                                                                                                                                                                                                                                                                                    
                                                                       PROTEIN --- Ce ---- 5e-009     NP_508597.2 WaRThog (hedgehog-like family) family member (wrt-6) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 3e-080     BAC06181.1 hedgehog homolog 2 [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 6e-083     NP_524459.2 hedgehog CG4637-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 2e-085     NP_001012720.1 hedgehog [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bb ---- 2e-105     CAB58231.2 hedgehog protein [Branchiostoma belcheri] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bf ---- 7e-106     CAA74169.1 AmphiHh protein [Branchiostoma floridae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ==== 3e-107     AAI25726.1 Unknown (protein for MGC:146164) [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 3e-134     NP_571138.1 sonic hedgehog [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 7e-141     NP_000184.1 sonic hedgehog preproprotein [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 4e-143     NP_033196.1 sonic hedgehog; short digits [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 4e-148     NP_990152.1 sonic hedgehog [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 7e-168     AAA85162.1 sonic hedgehog [Xenopus laevis]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT42783.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAG---------------------------------------------------------------------------------------------TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Tad5 FLq                         XZT25112.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGTGCAGCCCTGCTTGCGCTTATTGCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGTGAGAGAGCTGCGCCCCGGGGACCGGGTCCTCTCCTCCGACCCCCAAGGGAATCTCATCTACAGCGATTTCCTCCTGTTCATAGACAAGGAGCATGACGTCAAGAAGCTCTATTACGTCATCCAGACGTCTCAGACCCGAATCCGGATGACGGCGGCCCACCTGCTTTTCGTGGCCCAGAGCAACGGAACCGGGTCTTTCAAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAGGTTGACCTTGAGGAGGACATTGGGGCTTTTGCCCCCGTAACTGCCCAGGGGACTGTGGTTATAGACGAGGTGTTGGCCTCCTGCTATGCAGTCATTGAGGAGCATAGGTGGGCACACCTGGCATTCGCCCCACTGAGGTCGGCCATTAGCCTTTCATCCTATCTTTTCCCCAGAGACTCCAGTCCTTCGCTTGAATCGTACGAGCAAGTTGAAGGCATTCACTGGTACTCCCGACTACTTTATCACCTAGGGACTTGGCTATTGGACAGTAAGTCCCTGCACCCCCTGGGCATGGCGGCAACGAAATCCAGTTGAAAGTCCCCATTTCACTGCATTGAGACAAAAAAACAACAACTTTATTTTTCAAGTAGAACTTGTCTAAAGAGCCCAGATTTTCCTTTCACGGTTCTGTTTATTTTATTTCTCCCGTTCCCTTTTTTTTTTGTTTTATATATTATTTTGTATTTTTTTCGTTTTATTTCGTATTGTTTTTACGATTTCCTACTGAATATTTATTTGTTTTGGCATTTGACTAGATGTTTCAAAATGGACATTGGAGAAGCCTTAAATAGTTACTTGGATAATTTATTATCACGCATACCTGGGGTGGCCTCACGATAGAGTTGGTCTTGGGGAGACCCCCCCCACCCCCCCAAAAAAAAAACGCTCAGCAGAGTCTATTTTTCTACATGTCACTTATGTTTTGACTTTCACAAAAAACACATTTATCGTGTATTTTCCCCCCCCCCTTCCCCCCCAGACCAGACCTTCCAAGGAGGTGTCCACACAACTACTAAGGTCTCCCCCCCCCCCCCCCCCATTTTTAGTGAAAGTGTTACCTATTTGTAAACGACTTGCCTGGGCGAGGTTCAATAAATTATATTTTTATACACAGAATTGTAAATTAGATTTTTGCAGAAAATCAAATACTTAACTGAATGACATTTCGTTTTCCGAAATAGTTGTACATTACGAGAATATATTATTTTAATTTAAAGATAGTTTCACACGATAATAACGTTCTCTTCTATTCCTTTTCGTTATTTTTCGTTTTCGTTTTAATATTTTTGTTGTTGTTTATGTATAAAAAAATAGGGATCGGTCGCCTTCATGTCAATCCAGACTGTTACACCCACATCAGAGACAAACGAAAAAAAATAAATAAACCAAAACTAATACGAATATTATAGTTTCTAACCTCAAAAAAGAGTTTATTAGAGTATGATATTTTTTAAAAGAAGAAAAAAAATAACAAAAGAACGAAAAACAAAGCGCACATAGAGAGAAGCCAGAGGATGAAGACTGTTTGTACGAGACTTTAGGGGACTTTGCGTTAATACACTGAGAAATAACCGCTGTAAATTGACTAAAATGTATTTTGTAATTATTTTGTAATAGTTTTAATAGTTTTATAGAAATAAAATGTGCCATGCACAGCTTGCTTGGTATTTAATACTGAAAAAAAAAAAAAAAA
  5   1   2   12  bld Tad5 FLq  out                        XZT25112.5p ......................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGCAGCCCTGCTTGCGCTTATTGCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGTGAGAGAGCTGCGCCCCG
  5   1   2       bld Tbd0      out                      IMAGE:6977376                                                                                                                                                                                                                                                                                                                                                    GCAGCCCTGCTTGCGCTTATTGCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAAATTGGCTTCCCCTCGGAACAAAATGCCGGGTTGTGACTCCAAATTCTGCCGGCCGGGGCCTTCACCCGGAACCCCGGGGGGCCCCCCCCCTGGGGCTTGGCATTGGGGGAACCCGGGCAAAAAGGCCTTTGGCCAAAAGGGAGGCCCCCCCAAAAAAAAACCCCCCCCCCTTTTACCCCAAAAAAAAAAGTTTTTTTTCCCCCCAAAAAAGGGGGGTAAAAAAAAAACACCCCCTGGGGGGGCCCCCAGGGGTGCCCCTTTCCCCGGGGGGAAAAAATTTTTTCCCGGGGGGAACACCGGGAAAAAAAATTTTTTTAAAAAAGGTTTTTCCCCCCCCCCCCCCTTTTTTTAAAACCCCCCCGCAGAAAAAAAATATTTTTTTTTAATTTACCCCCCCGGGGGGGAAAAAAAAACCCCCGCGGAGGAGAAAAAAAAAAACCCCCCCCCCCCCCTGGGGGGCCCCCCTCAAAAAAATTTTTTTTGTGGGCGAGAAAATACCTTTTAAAAAACCCCCCCCCGTGGGGGGGGAGAAATTCTCCCCCGGGGGGGAGAAGAAAAAAAACACCAAATTTTTCCCCCCGGGGGGGGGGGGGGGAAAAAAAAAAAAACCGGGGGGGGGGTGCGCTCCAAAAAAAGAGAGGAGGGGGGTGGGGTGGAGGTGAAAAAAAAAAAAAAGAGAGGCCNCCCCCCCCCCCCCCCTCCCCTCCAGAAAG
  5   1   2       bld Neu  5g                        TNeu023n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                        CCCTGCTTGCGCTTATTGCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGATGTAAGGACAAGCTGAACGCCTTGGCGATCTCAGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTCA
  5   1   2   12 seed Tad5 5g3  out                        XZT42783.5p ........................................................................................................................................................................................................................................................................................................................................................................GCAATCGCAGCTTCTCATTTGCGCTTTAATTGCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGATGTAAGGACAAGCTGAACGCCTTGGCGATCTCAGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTCACGGAGGGTTGGGATGAGGATGGGCACCACTCGGAGGAGTCGCTGCATTACGAGGGGAGAGCAGTGGACATTACCACGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGCCAGGCTGGCGGTGGAAGCCGGGTTCGACTGGGTCTATTTTGAGTCCAAGGCTCACATCCACTGCTCGGTCAAAGCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGC
  5   1   2   12  bld Gas7 5g3  out                        XZG65438.5p .......................................................................................................................................................................................................................................................................................................................................................................................................GCTGTGTCGCCTCTAAACCCCGATGTGTTCTGCTAGCGGGGACCTGCACACTGGGCTTTCTACACCTGCCTTGCTAGGGATCGGTGGCTAGTGGGGCCAGCCGGGAGGTACAAGGACACCCCAGTGCTCCAGCCAGTAGGGAGGCTGCAGCTCCACATCCTCCGAGCCTTTGATGTAATTGGCTTCGCTCGGACGAGATGCTGGTTGTGACTCGAATTCTGCTGCTGGGCTTCATCTGTACTCTGGTGGCCCCCCCTGGGCTGGCATGTGGACCTGGCAGAGGCATTGGCAAAAGGAGGCACCCTAAAAAACTCACCCCTTTAGCCTACAAGCAGTTCATCCCCAACGTGGCTGAGAAGACCCTGGGGGCCAGTGGTCGATACGAAGGAAAGATTACAAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGATGTAAGGACAAGCTGAACGCCTTGGCGATCTCAGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTCACGGAGGGTTGGGATGAGGATGGGCACCACTCGGAGGAGTCGCTGCATTACGAGGGGAGAGCAGTGGACATTACCACGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGCCAGGCTGGCGGTGGAAGC
  5   1   2       bld TpA       out                  TTpA011g13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGACCTGGGGGCCAGTGGTCGATACGTAGGAAAGATTACAGGAACTCGGATCGATTTAAAGAGTTAACCCCCAATTATAACCCTGATATTATTTTTAAAGACGAGGAGAACACCGGAGCAGACCGACTCATGACTCAGAGATGTAAGGACAAGCTGAACGCCTTGGCGATCTCAGTGATGAACCAGTGGCCGGGGGTGAAGCTGCGGGTCACGGAGGGTTGGGATGAGGATGGGCACCACTCGGAGGAGTCGCTGCATTACGAGGGGAGAGCAGTGGACATTACCACGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGCCAGGCTGGCGGTGGAAGCCGGGTTCGACTGGGTCTATTTTGAGTCCAAGGCTCACATCCACTGCTCGGTCAAAGCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGTGAGAGAGCTGCGCCCCGGGGACCGGGTCCTCTCCTCCGACCCCCAAGGGAATCTCATCTACAGCGATTTCCTCCTGTTCATAGACAAGGAGCATGACGTCAAGAAGCTCTATTACGTCATCCAGACGTCTCAGACCCGAATCCGGATGACGGCGGCCCACCTGCTTTTCGTGGCCCAGAGCAACGGAACCGGGTCTTTCAAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAGGTTGACCTTGAGGAGGACATTGGGGGCTTTTGCCCCCGTAACTGCCCAGGGGACTGTGGTTATAGACGAAGTGTGGGCCTCCTGCTATGCAGTCATTGA
  5   1   2       bld In62 PIPE                       IMAGE:8954861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAAGGGGTTGGCGATTGAAGGATTGGGCACCACTCGGAGGAGTCGCTGCATTACGAGGGGAGAGCAGTGGACATTACCACGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGCCAGGCTGGCGGTGGAAGCCGGGTTCGACTGGGTCTATTTTGAGTCCAAGGCTCACATCCACTGCTCGGTCAAAGCAGAAAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGTGAGAGAGCTGCGCCCCGGGGACCGGGTCCTCTCCTCCGACCCCCAAGGGAATCTCATCTACAGCGATTTCCTCCTGTTCATAGACAAGGAGCATGACGTCAAGAAGCTCTATTACGTCATCCAGACGTCTCAGAACCGAATCCGGATGACGGCGGCCCACCTGCTTTTCGTGGCCCAGAGCAACGGAACCGGGTCTTTCAAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAAGTTGACCTTGAGGAGGACATTGGGGCTTTTGCCCCCGTAACTGCCCAGGGGACTGTGGGTTATAGACGAGGTGTTGGCCTCCTGCTATGCAGTCATTGAGAGCATAGTGGGCACAACCTGGCATCGCCCCACTGAGTCGGCATTAGCTTCATCTATCTTTCCCCGAGACTCAGTCTCGCTAGATCGTACGAGCAGTGAAGCATCACTGTACCTCCGACTCACTTATCACCTAGGACTG
  5   1   2       bld Neu                           TNeu067o14.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATCCCCGGGGTCGGACCGGGACCGCAGTAAATACGGGATGCTGGGCAGGCTGGCGGTGGAAGCCGGGTTCGACTGGGTCTATTTTGAGTCCAAGGCTCACATCCACTGCTCGGTCAAAGCAGAGAACTCGGTGGCGGCCAAGTCGGGGGGGTGCTTCCCGGGCAGTGCCAGGGTGATGGTGGAACCGGGCGGCACCAAAGCGGGGAGAGAGCTGCGCCCCGGGGACCGGGTCCTCTCCTCCGACCCCCAAGGGAATCTCATCTACAGCGATTTCCTCCTGTTCATAGACAAGGAGCATGACGTCAAGAAGCTCTATTACGTCATCCAGACGTCTCAGACCCGAATCCGGATGACGGCGGCCCACCTGCTTTTCGTGGCCCAGAGCAACGGAACCGGGTCTTTCAAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAAGTTGACCTTGAGGAGGACATTGGGGCTTTTGCCCCCGTAACTGC
  5   1   2       bld Tad5      out                           XZT51.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGACCGGGTCTTTCAGTCTGTGTTTGCCAGCAACGTCCGACCTGGGGATGTCATTTATAGCGCAGATCGGAGGGATATGACCTTGAGGGAGGCGATGGTGGAGAAGGTTGACCTTGAGGAGGACATTGGGGCTTTTGCCCCCGTAACTGCCCAGGGGACTGTGGTTATAGACGAGGTGTTGGCCTCCTGCTATGCAGTCATTGAGGAGCATAGGTGGGCACACCTGGCATTCGCCCCACTGAGGTCGGCCATTAGCCTTTCATCCTATCTTTTCCCCAGAGACTCCAGTCCTTCGCTTGAATCGTACGAGCAAGTTGAAGGCATTCACTGGTACTCCCGACTACTTTATCACCTAGGGACTTGGCTATTGGACAGTAAGTCCCTGCACCCCCTGGGCATGGCGGCAACGAAATCCAGTTGAAAGTCCCCATTTCACTGCATTGAGACAAAAAAACAACAACTTTATTTTTCAAGTAGAACTTGTCTAAAGAGCCCAGATTTTCCTTTCACGGTTCTGTTTATTTTATTTCTCCCGTTCCCTTTTTTTTTTGTTTTATATATTATTTTGTATTTTTTTCGTTTTATTTCGTATTGTTTTTACGATTTCCTACTGAATATTTATTTGTTTTGGCATTTGACTAGATGTTTCAGAATGGACATTGGAGAAGCCTTAAATAGTTACTTGGATAATTTATTATCACGCATACCTGGGGTGGCCTCACGATAGAGTTGTCCTTGGGGAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)