Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012087460 Xt7.1-CAAP12235.3 - 7 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAP12235.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCCAGTCTGTTCATCACAATCCTCAGCAATCTCAAAACCTTATCATGGCACCAATCTCCGGAGTGATGGCAATTACGCAGAATTTAAACACCTCTCAGGCGCAAAGTGTTCCTGTTATCAACAGTGTTGCAGGGAGCCTGGCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGACATGAAAACAAAATATTTCTTTATAAGAAGGTAATTTG
                                                  Xt7.1-CHK-1008239783                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCTGTTCATCACAATCCTCAGCAATCTCAAAACCTTATCATGGCACCAATCTCCGGAGTGATGGCAATTACGCAGAATTTAAACACCTCTCAGGCGCAAAGTGTTCCTGTTATCAACAGTGTTGCAGGGAGCCTGGCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGACATGAAAACAAAATATTTCTTTATAAGAAGGTAATTTGTTGAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     2     4     2     4     2     4     2     4     2     4     2     5     2     5     2     5     2     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     2     3     2     3     2     3     2     3
                                                                       ...PROTEIN --- Gg ---- 2e-030     NP_001025839.1 transcription factor 1, hepatic [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-050     NP_571955.2 transcription factor 2, hepatic [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-064     NP_033356.2 transcription factor 2 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-066     NP_000449.1 transcription factor 2 isoform a [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-073     AAH60009.1 MGC68543 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 1e-073     NP_001083280.1 hypothetical protein LOC398842 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xt ---- 7e-074     CAJ82369.1 transcription factor 2 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAP12235.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG---------------ATG------------------------------ATG---------------------------------------------------------ATG---------------------------------------ATG---------------------------------TGATGA---------------------------------------------------------------------TAA------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAATGTAG------ATG------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           Neu  FLt5                   TNeu141k07.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGCCAGTGAGTACACTGACCAATATTCACAACCTGTCCCAGTCTGTTCATCACAATCCTCAGCAATCTCAAAACCTTATCATGGCACCAATCTCCGGAGTGATGGCAATTACGCAGAATTTAAACACCTCTCAGGCGCAAAGTGTTCCTGTTATCAACAGTGTTGCAGGGAGCCTGGCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGACATGAAAACAAAATATTTCTTTATAAGAAGGTAATTTGTTGAATAATTGTAAAAATGTAGAAAAGTGCAATTTTTTGTACATATTATAAAAAAAATAATGCTTGGGCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7                                 XZG15126.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAGAACTAGTCGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTCTGGAGGAGGATTACCGCCAGTGAGTACACTGACCAATATTCACAACCTGTCCCAGTCTGTTCATCACAATCCTCAGCAATCTCAAAACCTTATCATGGCACCAATCTCCGGAGTGATGGCAATTACGCAGAATTTAAACACCTCTCAGGCGCAAAGTGTTCCTGTTATCAACAGTGTTGCAGGGAGCCTGGCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACTACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGACCAAAGTATTTTCCTTAAATAAACAAC
  3  -1   2       bld Kid1      in                         CABA2765.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGAATATAGGGTATTTATCTTATTGATGCCACTGGCCCTTTAATGACTTTGAGGTCAGTCTGTACTGACTACCATACATAGGATCTTCCTGGCGTCTTCTTATCTTGGTCTAACAATATTTGCTCTCTGGTAAAATGTCTCCAAGGCCACGGCTTGCTTTCTGTGTATATTTGTGTAGTTGCTGCAGAGTTAGAAATGCTGAAAGGTCTTTACCATACTCCTATTTTAAAGTAATAAAAAAAATCTTTTCAGGTATTTTAAAACTATGCCGGTAGTCAAACAGACATACAGATTACTATTGCAGCTAGATGTCATATAGGACACGAGAAGAGTTTATGGCCAGGTAGTGCTGCCATAAAATGCATTTAGCGGTGCCATAAACTAATGTTCTCAAATGATGCTGACTTGCCATAACTGAATATATATACCTTTTCCTCTCTTCCCCCTTACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGAC
  3  -1   2      seed Int1 PIPE in                        CAAP12235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCTGAGGATTGTGATGAACAGACTGGGACAGGTTGTGAATATTGGTCAGTGTACTCACTGGCGGTAATCCTCCTCCAGAAACAGATATCAGTTTGCCATCAGGTGAAAGCATGCCGTGGCTGTGATCCAAGCCCACTGGAGAAACTTGCTGTAAAACAGTGTTGCAGGGAGCCTGGCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGA
  5   1   2       bld Neu  FLt5                      TNeu141k07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGCCATGAGTCACTGACCAATTTACAACCTGTCCCAGTCTGTTCATCACAATCCTCAGCAATCTCAAAACCTTATCATGGCACCAATCTCCGGAGTGATGGCAATTACGCAGAATTTAAACACCTCTCAGGCGCAAAGTGTTCCTGTTATCAACAGTGTTGCAGGGAGCCTGGCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATT
  5  -1   2       bld Kid1      in                         CABA2765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTGGTAAAATGTCTCCAAGGCCACGGCTTGCTTTCTGTGTATATTTGTGTAGTTGCTGCAGAGTTAGAAATGCTGAAAGGTCTTTACCATACTCCTATTTTAAAGTAATAAAAAAAATCTTTTCAGGTATTTTAAAACTATGCCGGTAGTCAAACAGACATACAGATTACTATTGCAGCTAGATGTCATATAGGACACGAGAAGAGTTTATGGCCAGGTAGTGCTGCCATAAAATGCATTTAGCGGTGCCATAAACTAATGTTCTCAAATGATGCTGACTTGCCATAACTGAATATATATACCTTTTCCTCTCTTCCCCCTTACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGACATGAAAACAAAATATTTCTTTATAAGAAGGTAATTTGTTGAATAATGTAAACCTCGTGCCGAATTG
  5   1   2       bld Gas7                                 XZG50429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGCTTTACAATCTGTACAGTTTTCACAGCAACTACATAGTCCACATCAGCAGCAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGACATGAAAACAAAATATTTCTTTATAAGAAGGTAATTTGTTGAATAATTGTAAAAATGTAGAAAAGTGCAATTTTTTGTACATATTATAAAAAAAATAATGCTTGGG
  5   1   2       bld Int1 PIPE in                        CAAP12235.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACTCATGCAACAGTCCCCTGGGCACATGGCACAACAGCCATTTATGGCCACTGTCACTCAGCTTCAGAATTCACACATGTATGCACACAAGCAAGAGCCTCCCCAGTATTCCCACACATCTCGTTTTCCTTCAGCCATGGTTGTCACAGATACTAGCAGCATCAGCACATTATCAAACATGTCTTCCAGTAAACAGTGTCCTTTGCAAGCATGGTGATGAACAATATTATCCAAGTATTTCATATTTTTGCTCCTGAAGTCTTCTGCTGCTTGTTGCTGCTCACAGGAATAATACCAAAAGGCCCTTAATGTTGTACCTCTAATGTTGGATGTACCACATGTGCTTAAGTACACTTGCATTGCAGTCCCTTTTGCAGTATTTCCAGGAAGAGCATTCAAGGCCAAAGTATTTTCCTTAAATAAACAACTGGGAACAGAACAAATTTTTGTGGGAAAACCACAAAGGAAGACTAAAGATAAACGGACAGCTAAAAACTGAATGTAGAAATCTATGCATACATTGAACTGAGCCAATGTAAATATCTTTTTATTAAGACATGAAAACAAAATATTTCTTTATAAGAAGGTAATTTGTTGAATAATTGTACAAATGTAGAAAAGCATCATTTTTTGCCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)