Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 92%

 1012087739 Xt7.1-TTpA072l03.5 - 7 ESTs
                                                                       .-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA072l03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGATGGACCTATTTGAAACAAATTCCTATTTCTTTTACCTGGACGGAGATAACGGAGCCTTTCAACAACTGGGAGTAGCAGATGGGTCACCTGTTTATCCAGGTAGTGAGGGGACTTTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAGGAAGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGCCCTGGGCAGTGTCTCATCTGGGCCTGCAAGACGTGCAAGAGAAAGTCTGCTCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGAAGAAGGCTAAAGAAAATCAACGAAGCCTTTGAGGCTCTTAAAAGGAGGACTGTGGCAAACCCAAACCAAAGACTTCCAAAGGTTGAAATCCTACGCAGTGCCATTAATTATATTGAGAGGCTCCAGGACCTTTTGCACAGTTTGGATCAGCAGGACAAGCCACCGAAAGCAGACGAGGAACCCTTCTCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAATCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTCAGCTTCCCAAATTTCCTAATCACAGTTATGGGAGCAACTGCTCTACTATTCCCCATTTATTTAACAAGCGACTGTTGGATTCAATCCTGTTGCACTGAAGTGACATTATATTTTACAGACCACATTTGCTTTGTCTCACCAAAAATTTCCTCTGTCATTATTTAAAATGCCAATATATCCACTACATTCAACATAAATTCATTCCTGATTGTGCAAAGTGCAGAGATTATATTTTATATTTGTAATTATGGACGGTGTTGGAAATGTTCACGTTCCTTGTAAATAATCATATATTACTGTTCTACAAGCACTCATATTATTTAAACTATGGTTTGGAATGGTGAATATAGAAATATTACAATATATATCCTACTAAATAAACTTTGTTGTTAAGAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008238896                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACCTATTTGAAACAAATTCCTATTTCTTTTACCTGGACGGAGATAACGGAGCCTTTCAACAACTGGGAGTAGCAGATGGGTCACCTGTTTATCCAGGTAGTGAGGGGACTTTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAGGAAGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGCCCTGGGCAGTGTCTCATCTGGGCCTGCAAGACGTGCAAGAGAAAGTCTGCTCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGAAGAAGGCTAAAGAAAATCAACGAAGCCTTTGAGGCTCTTAAAAGGAGGACTGTGGCAAACCCAAACCAAAGACTTCCAAAGGTTGAAATCCTACGCAGTGCCATTAATTATATTGAGAGGCTCCAGGACCTTTTGCACAGTTTGGATCAGCAGGACAAGCCACCGAAAGCAGACGAGGAACCCTTCTCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAATCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTCAGCTTCCCAAATTTCCTAATCACAGTTATGGGAGCAACTGCTCTACTATTCCCCATTTATTTAACAAGCGACTGTTGGATTCAATCCTGTTGCACTGAAGTGACATTATATTTTACAGACCACATTTGCTTTGTCTCACCAAAAATTTCCTCTGTCATTATTTAAAATGCCAATATATCCACTACATTCAACATAAATTCATTCCTGATTGTGCAAAGTGCAGAGATTATATTTTATATTTGTAATTATGGACGGTGTTGGAAATGTTCACGTTCCTTGTAAATAATCATATATTACTGTTCTACAAGCACTCATATTATTTAAACTATGGTTTGGAATGGTGAATATAGAAATATTACAATATATATCCTACTAAATAAACTTTGTTGTTAAGAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     3     4     4     4     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     7     6     7     6     7     6     7     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     2
                                               BLH ATG       1     673                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 3e-018     NP_494798.4 Helix Loop Helix family member (hlh-1) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 9e-029     AAB61359.1 MyoD-family protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 2e-032     XP_781762.2 PREDICTED: similar to Transcription factor SUM-1 (Sea urchin myogenic factor 1) [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bb ---- 4e-034     BAC16742.1 MyoD-related [Branchiostoma belcheri] -------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 1e-033     NP_476650.1 nautilus CG10250-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 4e-036     AAN87801.2 myogenic regulatory factor 1 [Branchiostoma floridae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Br ---- 7e-037     AAR12639.1 MyoD [Branchiostoma belcheri tsingtaunese] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 1e-076     NP_001003982.1 myogenic factor 6 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Mm ==== 1e-096     NP_032683.1 myogenic factor 6 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Hs ==== 3e-098     NP_002460.1 myogenic factor 6 (herculin); Myogenic factor-6 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Gg ==== 1e-101     NP_001025917.1 myogenic factor 6 (herculin) [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 3e-137     AAY40357.1 MRF4b [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = ?? ==== 3e-137     NP_001088572.1 hypothetical protein LOC495450 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 2e-141     NP_001017160.1 myogenic factor 6 (herculin) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA072l03.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TAATAG---------------------------------------------------TAA------------------------------------------TAA------------------------------------TGA---------------------------------------------------------------ATG------------------------TAA---------TGA---------------------------------------ATG---------------------------------TAA---------------------------------------------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2       chi TbA  5g                        TTbA017d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAATCAAGGGCAAAGCATAATGATGGACCTATTTGAAACAAATTCCTATTTCTTTTACCTGGACGGAGATAACGGAGCCTTTCAACAACTGGGAGTAGCAGATGGGTCACCTGTTTATCCAGGTAGTGAGGGGACTTTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAGGAAGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGCCCTGGGCAGTGTCTCATCTGGGCCTGCAAGACGTGCAAGAGAAAGTCTGCTCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGAAGAAGGCTAAAGAAAATCAATGAAGCCTTTGAGGCTCTTAAAAGGAGGACTGTGGCAAACCCAAACCAAAGACTTCCAAAGGTTGAAATCCTACGCAGTGCCATTAATTATATTGAGAGGCTCCAGGACCTTTTGCACAGTTTGGATCAGCAGGACAAGCCACCGAAAGCAGACGAGGAACCCTTCTCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAACCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATTCCTGACCATTCCAGAATGCCCAACCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTC
  5   1   2   10 seed Tail 5g3  in                         CBSW5754.b1 ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCAAAGCATAATGATGGACCTATTTGAAACAAATTCCTATTTCTTTTACCTGGACGGAGATAACGGAGCCTTTCAACAACTGGGAGTAGCAGATGGGTCACCTGTTTATCCAGGTAGTGAGGGGACTTTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAGGAAGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGCCCTGGGCAGTGTCTCATCTGGGCCTGCAAGACGTGCAAGAGAAAGTCTGCTCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGAAGAAGGCTAAAGAAAATCAACGAAGCCTTTGAGGCTCTTAAAAGGAGGACTGTGGCAAACCCAAACCAAAGACTTCCAAAGGTTGAAATCCTACGCAGTGCCATTAATTATATTGAGAGGCTCCAGGACCTTTTGCACAGTTTGGATCAGCAGGACAAGCCACCGAAAGCAGACGAGGAACCCTTCTCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAATCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCA
  5   1   2       bld TpA  5g3  in                   TTpA072l03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATAATGATGGACCTATTTGAAACAAATTCCTATTTCTTTTACCTGGACGGAGATAACGGAGCCTTTCAACAACTGGGAGTAGCAGATGGGTCACCTGTTTATCCAGGTAGTGAGGGGACTTTGTCCCCATGTCGTGATCAGCTGCCGGCAGATGCTGGAAGTGACAGTAGTGAGGAAGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGCCCTGGGCAGTGTCTCATCTGGGCCTGCAAGACGTGCAAGAGAAAGTCTGCTCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGAAGAAGGCTAAAGAAAATCAACGAAGCCTTTGAGGCTCTTAAAAGGAGGACTGTGGCAAACCCAAACCAAAGACTTCCAAAGGTTGAAATCCTACGCAGTGCCATTAATTATATTGAGAGGCTCCAGGACCTTTTGCACAGTTTGGATCAGCAGGACAAGCCACCGAAAGCAGACGAGGAACCCTTCTCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAACCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTCAGCTTCCCAAATTTCCTAATCACAGTTATGGGAGCAACTGCTCTACTATTCCCCATTTATTTAAACAGCGACTGTTGGATTTCATCCTGTTGCACTGAAGTGACATTATATTTTACAGACCACATTTGCTTTGTCTCACCAAAATTTCCTCTGT
  5   1   2       bld TpA  FL   in                   TTpA009b17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGATGGACCTATTTGAAACAAATTCCTATTTCTTTTCCTGGACGGAGATAACGGAGCCTTTCAACAACTGGGAGTAGCAGAATGGGTCACCTGTTTATCCAGGTAGTGAGGGGACTTTGTCCCCATGTCGTGATCAGCTGCCAGCAGATGCTGGAAGTGACAGTAGTGAGGAAGAACATGTCTTAGCTCCACCAGGACTACAACCCCACTGCCCTGGGCAGTGTCTCATCTGGGCCTGCAAGACGTGCAAGAGAAAGTCTGCTCCAACTGACAGAAGAAAAGCAGCCACCCTAAGGGAAAGAAGAAGGCTAAAGAAAATCAACGAAGCCTTTGAGGCTCTTAAAAGGAGGACTGTGGCAAACCCAAACCAAAGACTTCCAAAGGTTGAAATCCTACGCAGTGCCATTAATTATATTGAGAGGCTCCAGGACCTTTTGCACAGTTTGGATCAGCAGGACAAGCCACCGAAAGCAGACGAGGAACCCTTCTCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAATCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAG
  3   1   2       bld Tail 5g3  in                         CBSW5754.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTTATAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAATCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTCAGCTTCCCAAATTTCCTAATCACAGTTATGGGAGCAACTGCTCTACTATTCCCCATTTATTTAACAAGCGACTGTTGGATTCAATCCTGTTGCACTGAAGTGACATTATATTTTACAGACCACATTTGCTTTGTCTCACCAAAAATTTCCTCTGTCATTATTTAAAATGCCAATATATCCACTACATTCAACATAAATTCATTCCTGATTGTGCAAAGTGCAGAGATTATATTTTATATTTGTAATTATGGACGGTGTTGGAAATGTTCACGTTCCTTGTAAATAATCATATATTACTGTTCTACAAGCACTCATATTATTTAAACTATGGTTTGGAATGGTGAATATAGAAATATTACAATATATATCCTACTAAATAAACTTTGTTGTTAAGAAAATAAAAAAAAAAAAAAA
  3   1   2       bld TpA  FL   in                    TTpA009b17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAACTCCAAAGAGGCAGCTGTTCAGAGCGAGGATTTCTTAAATACCTGTCATCCTGAATGGCACCATATTCCTGACCATTCCAGAATGCCCAATCTCAATATTAAAGAAGAAGGATCCCTACAGGAGAATTCCTCTTCCAGCAGCCTGCAGTGCCTCTCCTCTATAGTGGACAGCATATCTTCTGATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTCAGCTTCCCAAATTTCCTAATCACAGTTATGGGAGCAACTGCTCTACTATTCCCCATTTATTTAACAAGCGACTGTTGGATTCAATCCTGTTGCACTGAAGTGACATTATATTTTACAGACCACATTTGCTTTGTCTCACCAAAAATTTCCTCTGTCATTATTTAAAATGCCAATATATCCACTACATTCAACATAAATTCATTCCTGATTGTGCAAAGTGCAGAGATTATATTTTATATTTGTAATTATGGACGGTGTTGGAAATGTTCACGTTCCTTGTAAATAATCATATATTACTGTTCTACAAGCACTCATATTATTTAAACTATGGTTTGGAATGGTGAATATAGAAATATTACAATATATATCCTACTAAATAAACTTTGTTGTTAAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                   TTpA072l03.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATGAACCCAAGCACCCTTGCACTATACAGGAGCTGGTAGAGAATTAATAGCACCCCTCTCTAGCGCTTCATGGCTCTACCAGCTCAGCTTCCCAAATTTCCTAATCACAGTTATGGGAGCAACTGCTCTACTATTCCCCATTTATTTAACAAGCGACTGTTGGATTCAATCCTGTTGCACTGAAGTGACATTATATTTTACAGACCACATTTGCTTTGTCTCACCAAAAATTTCCTCTGTCATTATTTAAAATGCCAATATATCCACTACATTCAACATAAATTCATTCCTGATTGTGCAAAGTGCAGAGATTATATTTTATATTTGTAATTATGGACGGTGTTGGAAATGTTCACGTTCCTTGTAAATAATCATATATTACTGTTCTACAAGCACTCATATTATTTAAACTATGGTTTGGAATGGTGAATATAGAAATATTACAATATATATCCTACTAAATAAACTTGTTGTTAGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)