Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT7235.5                            25 END     1           7        4                (no blast hit)

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2  50.0    0(repeat)                                    0 REP     89       1642     1824                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012087792 Xt7.1-CAAO11438.5 - 13 ESTs
                                                                       .-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAO11438.5                                                                                                                                                                                                                                                                                                                                                                TAAGGTGTTGCGGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCAGGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTATCAATATCAAGGAAACAATTGCCAACCACTGATAGAGATTCATAGACTGTATTGTCCAGCCAAGCATTTCTCACATGTAGCTGAATTTGGTCTTCAAACAATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACACGCCCAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTTAGTGTGAAGTCTGATAAGTATACATGGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATACCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTGCATCAGGGGTGGCCAAAACATCAATTGTGGTCCACCAGTCGCTCCCCTGTGGATTTCTGGTGGACCGCGTCGAAGCCGGGAAATGCGGAAGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCTTCGCGTATGTGCGCAGGGAGGAGTCAGAAGTCAATGGAAGCAGGGAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGAAGGAAAACTATACCCCTAGAATGAATACTTAACCAACAGACAGTGTATATTATGTTAAGTGGCCTATTAAAGAATCTCGCCAAACTGGAATATATATATCAATAAATATTGCCCTTTTACATCCTTTCCCTTGAGCCACCATTTAGTGATGGGCTGGGTGCTCCCTCAGAGATCA
                                                  Xt7.1-CHK-1008233860                                                                                                                                                                                                                                                                                                                                                                      CTTxxxGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCAGGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTATCAATATCAAGGAAACAATTGCCAACCACTGATAGAGATTCATAGACTGTATTGTCCAGCCAAGCATTTCTCACATGTAGCTGAATTTGGTCTTCAAACAATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACACGCCCAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTTAGTGTGAAGTCTGATAAGTATACATGGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATGCCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTGCATCAGGGGTGGCCAAAACATCAATTGTGGTCCACCAGTCGCTCCCCTGTGGATTTCTGGTGGACCGCGTCGAAGCCGGGAAATGCGGAAGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCTTCGCGTATGTGCGCAGGGAGGAGTCAGAAGTCAATGGAAGCAGGGAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGAAGGAAAACTATACCCCTAGAATGAATACTTAACCAACAGACAGTGTATATTATGTTAAGTGGCCTATTAAAGAATCTCGCCAAACTGGAATATATATATCAATAAATATTGCCCTTTTACATCCTTTCCCTTGAGCCACCATTTAGTGATGGGCTGGGTGCTCCCTCAGAGATCAGCTGAC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                     2     3     3     5     3     5     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     6     5     6     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                    GTGCGGGATGTG
                                               BLH ATG     120     660                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN     120      92                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR     120     707                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG     120      55                                                                                                                                                                                                                                                                                                                                                                
                                                                       PROTEIN --- Dm ---- 1e-037     NP_569851.2 CG13367-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ci ==== 1e-039     BAE93298.1 zinc finger protein [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Sp ==== 4e-067     XP_796303.1 PREDICTED: similar to ocular development associated gene [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 2e-106     XP_418653.2 PREDICTED: similar to GATAD1 protein [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 3e-112     NP_001035454.1 hypothetical protein LOC678617 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 1e-122     NP_066990.3 GATA zinc finger domain containing 1 [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 1e-122     NP_080309.1 ocular development associated gene [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 7e-131     AAH44066.1 Odag-pending-prov protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 7e-131     NP_001080603.1 ocular development associated [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAO11438.5                                                                                                                                                                                                                                                                                                                                                                TAA------TAA---------------------------------------------------------------------TAA------------------------------------ATG---------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAG---------------------------------------ATGTAG---------------------------------------TAA---------------------TAG---TAA------------------------ATG------------------------------TAA---------------------TAG---------------------------------------------------------------------------------TAGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------TAA---------TAA------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1           TbA  FL                     TTbA066h11.FL-Sanger                                                                                                                                                                                                                                                                                                                                                          AGACTTTAAGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCAGGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTATCAATATCAAGGAAACAATTGCCAACCACTGATAGAGATTCATAGACTGTATTGTCCAGCCAAGCATTTCTCACATGTAGCTGAATTTGGTCTTCAAACAATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACACGCCCAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCTAAACATTTTAGTGTGAAGTCTGATAAGTATACATGGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATGCCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTACATCAGGGGTGGCCAAAACATCAATTGTGGTCCACCAGTCGCTCCCCTGTGGATTTCTGGTGGACCGCGTCGAAGCCGGGAAATGCGGAAGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCGTCGCGTATGTGCGCACGGAGGAGTCAGAAGTCGATGGAAGCAGGAAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGAAGGAAAACTATACCCCTAGAATGAATACTTAACCAACAGACAGTGTATATTATGTTAAGTGTCCTATTAAAGAATCTTACCAACCTGGAATATATATATCAGTAAATATTGCCCTTTTATATCTTTTCCCTTGAGCCGCCATTTAGTGATGGGCTGTGTGCTCCCTCAGAGATCAACTGACAGGAAATAATGCAGCTCTAACTGTAACAGGAAGTAGCGTGGGAGTAAAAGGCAGAACTCTGCCCATTTATTGGCTGATGGAGCCTAGCATGTATGTGTGCCTTGGCTTGTTTGTGTGCACTGTGAATCATATGATCCCAGGAGGCGGCCCTTAATTCTTAAAATGGCAATTTTCTATTTAGCATTACCCAATAGCACATAATGTTAAAAAAGTATATTTTTATGAAAATGGTTTATTTAGATGAAGCAGGGATTTATATTTGAGCTTGTTTATGCAATATATTTTTATAGATACCTGCATTGTTAGGGGGTATAGTTTTCCTTTAATGATAGGCTAGAAAAAATGGATTTTTTTTAAAAAACAGGTATATCTACCCAAATACAAATTAACTAATTAATTAGAAGGGGAGGGAGCAATAAAAAAAAACAAAGAAACACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4                                 CAAN11448.5p                                                                                                                                                                                                                                                                                                          CAAGATGAGATTTGTGACGCCTGAATTAGCCGCTTGCGGAAGTGCGGGAGACTTTAAGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATA
  5   1   2   24 seed Te5  PIPE ?                         CAAO11438.5p ...........................................................................................................................................................................................................................................................................................................................ATTTGTGACGCCTGAATTAGCCGCTTGCGGAAGTGCGGGAGACTTTAAGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGC
  5   1   2       bld TbA  FL   ?                    TTbA066h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                            ACTTTAAGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGAATTGGAGATGGTGGTTTCTTGTTGTGGATGGAANGAAGATGGCAAAACATACTATGCCCAAAATCAGAGGTTTTGTACAGGATCAGTACTGGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAG
  5   1   2       bld Te1       in                         CBWN4090.b1                                                                                                                                                                                                                                                                                                                                                                   AGACTTTAAGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCA
  3   1   2       bld Te1       in                         CBWN4090.g1                                                                                                                                                                                                                                                                                                                                                                   AGACTTTAAGGTGTTGCGGGATATTTAAACAGCGATCTGGCGGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCA
  5   1   2       bld HdA  5g3  in                   THdA051m07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                              CTGGCGGTGCGGGATGTGCGGGATGTGCTGAGGAGCCGGACTATTGGGCGATAATTGGCAAATGAAAGGCCACAGCAAAATTATATCACGATGCCGCTGGGATTAAAGCCAACATGCAGCATGTGCAAAACCAACACATCTTCCATGTGGAAGAAGGGAAACCAGGGGGAGATCCTGTGTAATAACTGCAGTGGCAAGAGCAGCAGCAGCAGCAGCGGTGGTGGAAACAACAACAACAGCGGCGGTGGTGGAAGTACCAGTGGTAGCAGCTCTTATACTGGCACAAACTTTGCAAGTGCATCCACGTCCCAGCAGAGTAATGGTGGGAACACTAAGCAGTCCAAACAGGAAATCCACCGCAGATCAGCCCGACTAAGGAACACAAAGTACAAATCTACTCCGGCTGTTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAAATACTTCAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCANGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTA
  5   1   2       bld Tbd1      in                         CBXT2313.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGAAGGCACATATTTAAACTAAAAAATCCGATCAAGGCACCAGAGGCTGTATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCAGGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTATCAATATCAAGGAAACAATTGCCAACCACTGATAGAGATTCATAGACTGTATTGTCCAGCCAAGCATTTCTCACATGTAGCTGAATTTGGTCTTCAAACTATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACATGCACAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTT
  5   1   2       bld TpA       ?                    TTpA067k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATCTACCATCGTAACATCAGAGTCCATCTTCCATAAGGGACTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGATGAGGAAGATGGCAAAACATACTATGCCCAAATCAGAGGTTTTGTACAGGATCAGTACTGTGAGAAGAGTGCTGCCCTGACATGGCTCATCCCTACAATGTCCAGTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCAGGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTATCAATATCAAGGAAACAATTGCCAACCACTGATAGAGATTCATAGACTGTATTGTCCAGCCAAGCATTTCTCACATGTAGCTGAATTTGGTCTTCAAACAATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACACGCCCAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCTAAACATTTTAGTGTGAAGTCTGATAAGTATACATGGGGTCCAGGTGCACATACCTTAGACCTACAGCANAAGGAGGTTCATGCCACAGC
  5   1   2       bld Gas7      out                        XZG23842.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCAAAAGATGGGTTTGATCCCTCAACATACATTATAGGGCCAGATGAAGATCTCCCCAGAAAGATGGAGTGCTTAGAATTTGTGTGCCATGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCTCCTTTTCCTACTATTCCTACCAGGCCAGAAAAGGGATTTATTTGGACTCACATTGGCCCCACTCCAGCTATCAATATCAAGGAAACAATTGCCAACCACTGATAGAGATTCATAGACTGTATTGTCCAGCCAAGCATTTCTCACATGTAGCTGAATTTGGTCTTCAAACAATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACACGCCCAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCTAAACATTTTAGTGTGAAGTCTGATAAGTATACATGGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATGCCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTACATCAGGGGTGGCCAAAACAT
  3   1   2       bld Tbd1      in                         CBXT2313.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCACATGTAGCTGAATTTGGTCTTCAAACTATTTTTTTGCCAAAACAATTAAACGACGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACATGCACAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTTAGTGTAAAGTCTGATAAGTATACATCGGGTATACAGCAGACCTACAGCAAAAGGAGGTTCATGCCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTGCATCAGGGGTGGCCAAAACATCAATTGTGGTCCACCAGTCGCTCCCCTGTGGATTTCTGGTGGACCGCGTCGAAGCCGGGAAATGCGGAAGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCATCGCATATGTGCGCAGGGAGGAGTCAGAAGTCGATGGAAGCAGGAAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGAAGGAAAACTATACCCCTAGAATGAATACTTAACCAACAGACAGTGTATATTATGTTAAGTGTCCTATTAAAGAATCTTACCAACCTGAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                    THdA051m07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGAGCTTGTTACCTGTAGGGGTAAAGATTGGGTGCACACGCCCAGCGAATGTCAAGCAACCAATCAGCAGTGAGTTATGCCTAAAAGGAAGAACTGAAGAACTACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTTAGTGTGAAGTCTGATAAGTATACATGGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATGCCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTACATCAGGGGTGGCCAAAACATCAATTGTggtccaccagtcgctcccctgtggatttctggtggaccgcgtcgaagccgggaaatgcggaaGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCGTCACGTATGTGCGCACGGAGGAGTCAGAAGTCGATGGAAGCAGGAAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGaaggaaaactatacccctagaatgaatacttaaccaacagaccagtgtatattatgttaagtgtcctattaaagaatctTACCAAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas7                                  XZG9458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGTAGGGGTAAGATTGGGTGCACATGCACAGCGAATGTCAAGCAACCAATCAGCACTGAGCTATGCCTAAAAGGAAGAACTGAAGAACTAGATCTCTTTGGCTGAGAAACGGCCACTTTCATACAATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTTAGTGTAAAGTCTGATAAGTATACATCGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATACCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTGCATCAGGGGTGGCCAAAACATCAATTGTggtccaccagtcgctcccctgtggatttctggtggaccgcgtcgaagccgggaaatgcggaaGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCTTCGCGTATGTGCGCAGGGAGGAGTCAGAAGTCAATGGAAGCAGGGAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGaaggaaaactatacccctagaatgaatacttaaccaacagacagtgtatattatgttaagtggcctattanagaatctcgccaaactggaatatatatatcaataaatattgcccttttacatcctttcccttgagccaccatttagtgatgggctgggtgctccctcagagatcaGCTGACAG
  5   1   2       add Tad5      ?                          XZT66903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGCAATTAGATTAATACAATTCAGGGAAAATCCAGATGGTTCCACCTAGATGGGCAGGTTTCCTTCCTTTTCCAAACATTTTAGTGTAAAGTCTGATAAGTATACATCGGGTCCAGGTGCACATACCTTAGACCTACAGCAAAAGGAGGTTCATACCACAGCCAGAACAGCAGGCATTCATGGATCCCACGAAACAGGCTTGTATAAAAGAATTACAAACTTTATTGTAGGCCAACAGAAGATTATAGCCTTGCATCAGGGGTGGCCAAAACATCAATTGTggtccaccagtcgctcccctgtggatttctggtggaccgcgtcgaagccgggaaatgcggaaGTGTGGTGGTTCCGTGCGTTTATTGGATATGCGTATGTACGCTGCTTCGCGTATGTGCGCAGGGAGGAGTCAGAAGTCAATGGAAGCAGGGAAAAGTCTGGGCGCCCCTGCCTTATATGTTTCCTGCATAAAGCTCTTGaaggaaaactatacccctagaatgaatacttaaccaacagacagtgtatattatgttaagtggcctattaaagaatctcgccaaactggaatatatatatcaataaatattgcccttttacatcctttcccttgagccaccatttagtgatgggctgggtgctccctcagagatcagctgacaggaaataatgcagctctaactgtaacaggaagtagcgtgggagtaaaaggcagaactctgtccatttattggctgatggggcctagcatgtatgtgtgccttggcttgtttgtgtgcactgtgaatcctatgat

In case of problems mail me! (mike.gilchrist@crick.ac.uk)