Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK12876.5                           9 END     3          42       33                disabled homolog 1 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012087824 Xt7.1-CAAK12876.3 - 7 ESTs
                                                                       .........-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAK12876.3                                                                                                                                                      TTTTTAGCAGCACCTAAAGAAGAGGGTCACTGAAAGACATATTATTTTATTTCATATGACAACCATGTTTATGTGGGTTGGGAGGGGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTGAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGAAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTCTTCAAATGGAAAAGGCTTTAAGTAATTAACATACAATGACAGATTTTGTAAATATGAGTATTAATGACAAATGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAGCTTGTCAGAAACTAATAAACTGAATGAGGATCC
                                                  Xt7.1-CHK-1008239811                                                                                                                                                            GCAGCACCTAAAGAAGAGGGTCACTGAAAGACATATTATTTTATTTCATATGACAACCATGTTTATGTGGGTTGGGAGGGGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTGAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGAAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTCTTCAAATGGAAAAGGCTTTAAGTAATTAACATACAATGACAGATTTTGTAAATATGAGTATTAATGACAAATGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAGCTTGTCAGAAACTAATAAACTGAATGAGGATCCTCAAAA
                                                      consensus depths                                                                                                                                                           2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     5     5     4     4     4     4     4     4
                                                     Xt7.1-CAAK12876.3                                                                                                                                                                                    TGA------------------------------------------------------------------------------------------------TGA---------TAG------------------------------------------------------------------------------------------------------------------ATG------------------------TGA------ATG---------ATG------------------------------TAA------------------------------------ATG---TAG------------------------ATG---------------------------------------------------------TAG------------------------TAA---TAA---TAA---------ATG------------------TAA------ATG---------------ATG---------------------------------------TAG------------------TGA------------------------------------------------------------TAG------------TAATAA------TGA
  3   1   2      seed Brn3 5g3  out                       CAAK12876.3p AATATTTTATGACTACTTTACTTGTCATTTTTTCTTTATAAAAGTTTTTTATACTTATATATAAATAATGCAAACCCCCAATGTAGCAGCAGCAGTACCACAGAGGATTATGGAGGCTGAACGTTACACTGTTGTTCCTCATGGAAGCTTTTTTAGCAGCACCTAAAGAAGAGGGTCACTGAAAGACATATTATTTTATTTCATATGACAACCATGTTTATGTGGGTTGGGAGGGGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTGAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGAAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTCTTCAAATGGAAAAGGCTTTAAGTAATTAACATACAATGACAGATTTTGTAAATATGAGTATTAATGACAAATGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAGCTTGTCAGAAACTAATAAACTGAATGAGGATCCTTG
  3   1   2       bld Brn3 5g3  out                        CAAK9888.3p                                                                                                                                                      TTTTTAGCAGCACCTAAAGAAGAGGGTCACTGAAAGACATATTATTTTATTTCATATGACAACCATGTTTATGTGGGTTGGGAGGGGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTGAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGAAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTCTTCAAATGGAAAAGGCTTTAAGTAATTAACATACAATGACAGATTTTGTAAATATGAGTATTAATGACAAATGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAGCTTGTCAGAAACTAATAAACTGAATGAGGATCCTTGT
  3   1   2       bld Gas0                                 dad51c06.x1                                                                                                                                                                             GGGTCACTGAAAGACATATTATTTTATTTCATATGACAACCATGTTTATGTGGGTTGGGAGGGGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTGAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGANAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTTTCACAATGGAAAAAAA
  3   1   2       bld BrSp      out                    EC2BBA10DH08.b1                                                                                                                                                                               GTCAATGAAAGACATATTATTTTATTTCATATGACAACCATGTTTATGTGGGTTGGGAGGGGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTCAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGAAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTCTTCAAATGGAAAAGGCTTTAAGTAATTAACATACAATGACAGATTTTGTAAATATGAGTATTAATGACAAATGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCAAAAAAAGGTTTCATATCACATGGTTTTTTTCAAGTGCAAA
  3   1   2       bld Egg                             TEgg006l22.q1kT7                                                                                                                                                                                                                                           GGGAGGAAGGCTCAAAATACATTTTTTTTATAAAACCGCTCCATTGACCTTGGAACTAGAAGAAGAGATATATAAACTTTTATGGTCTACGTGGAAGCGGAAAGACGCCAAATATTCTAGACACTGAGAGATTCATAGATACACAAACAGACTTTCAGACAATAAAATTGAGGATGCTTCCTCATCTGGTACCTTGCTGCTGAAAAGCTATGCAGACTCCTATGTGTGCCATTTTTGAAGATCGAATATTTGCCTAAATAAAACTCTGGAACAAATCCAAATGGTGGATAGAAATGAAATAGACTTTCTCTGGGGACATTAGAGGCATGACTTTTGCTATAAGAGAATCTGTGATTAGATTACCCAATTCTGTCTCTTTTGTACATTAGGGGAAAAATTGGATTTTTATTTTATAATTGTAACATTAAACTCTTCAAATGGAAAAGGCTTTAAGTAATTAACATACAATGACAGATTTTGTAAATATGAGTATTAATGACAAATGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAGCTTGTCAGAAACTAATAAACTGAATGAGGATCCAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA35BH03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAG
  5   1   2       bld BrSp      in                     EC2BBA35BH03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGTTTCATATTGCCATTACACTGTAGCAAGATAGCGAATGTCAGTGATTGGAAGGTGTGTCATTTTCAGGTTTCATATCACATGGTTTTTTTCAAGTGCAGAGTAATTAGCTTGTCAGAAACTAATAAACTGAATGAGGATCCTCAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)