Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBXT8982.5                            3 END     1          10       33                Unknown (protein for MGC:161027) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012087861 Xt7.1-CAAN11402.3 - 10 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAN11402.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAATTCGAGTATTTGCTGTATGGTCACAGAGAACAGTTTGCATGCCAAGCATGTGGCAAAACATTTACAGATGAAGCTCGTCTAAGAAAACATGAAAAGTTACACACAGCAGATAGACCATTTGTCTGTGAAATGTGTGCCAAAGCATTTACAACCCAGGCACATCTCAAGGAGCATTTAAAAATTCACACAGGCTATAAGCCTTACAGTTGTGAGGTTTGTGCAAAGTCTTTTATTCGTGCTCCAGATCTCAAAAAACATGAACGCGTCCACAGTAATGAGAGACCATTTGCGTGCCATCTTTGTGATAAAGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCTTCAGACCTAAAACGCCATGAAAACAACATGCATAGTGAGCAACGCAAACAAGTCACAACCAGTGCCATACAGAGTGAGACTGAGCAATTGCAGGCAGCAGCTATGGCAGCAGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATAACATACGCTGGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAAACAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGCGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGTTAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008235719                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGAGTATTTGCTGTATGGTCACAGAGAACAGTTTGCATGCCAAGCATGTGGCAAAACATTTACAGATGAAGCTCGTCTAAGAAAACATGAAAAGTTACACACAGCAGATAGACCATTTGTCTGTGAAATGTGTGCCAAAGCATTTACAACCCAGGCACATCTCAAGGAGCATTTAAAAATTCACACAGGCTATAAGCCTTACAGTTGTGAGGTTTGTGCAAAGTCTTTTATTCGTGCTCCAGATCTCAAAAAACATGAACGCGTCCACAGTAATGAGAGACCATTTGCGTGCCATCTTTGTGATAAAGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCTTCAGACCTAAAACGCCATGAAAACAACATGCATAGTGAGCAACGCAAACAAGTCACAACCAGTGCCATACAGAGTGAGACTGAGCAATTGCAGGCAGCAGCTATGGCAGCAGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATAACATACGCTGGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAAACAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGCGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGTTAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     4     2     4     2     5     2     5     2     5     3     5     5     5     3     5     3     5     3     5     3     5     3     5     4     6     4     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     2     4     4     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Br ---- 5e-009     ABH05923.1 Ikaros-like protein [Branchiostoma belcheri tsingtaunese] ============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 3e-024     AAC35351.1 snail [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 2e-025     NP_014756.1 probable transcription factor, asparagine-rich zinc-finger protein, suppressorof mutation in the nuclear gene for the core subunit of mitochondrial RNApolymerase; Azf1p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-032     NP_492723.1 Drosophila ODD-skipped-like ODD-3 (odd-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-035     NP_723223.1 CG31632-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 2e-037     NP_001071858.1 zinc finger protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-036     XP_792487.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 9e-037     CAJ81888.1 novel protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 2e-094     NP_998701.1 zgc:66442 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN --- Gg ---- 5e-100     NP_990492.1 zinc finger 5 protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 1e-100     NP_033573.1 zinc finger protein 161 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 1e-100     NP_003400.2 zinc finger protein 161 homolog; zinc finger protein homologous to Zfp161 inmouse [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 4e-108     AAI33770.1 Unknown (protein for MGC:161027) [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PREDICTED - ?? ---- 4e-108     NP_001091416.1 hypothetical protein LOC100049107 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAN11402.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------TAA------------------------------------TAA---------------------------TGATAA---------------------------------------------------------------------------------------------------------------TGA---------------TGA---------TAG---------TAA------------------ATG---------TAA---------------------------------TAA---------------------TAA---ATG---TAA---------------ATG------------------------------------------------------------------TAA---------------TAG------------------------TAG---------------------TAA---TGA---------TAA------------------------------------ATG---------TAATGA---------TAAATGTAG---------------TAA---------------------------------------------------ATG---------TAA---------------------------------------------TAG---------------------------ATG---------------TAA------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  3   1   2       bld Egg       out                   TEgg070a20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACATGAAATTCGAGTATTTGCTGTATGGTCACAGAGAACAGTTTGCATGCCAAGCATGTGGCAAAACATTTACAGATGAAGCTCGTCTAAGAAAACATGAAAAGTTACACACAGCAGATAGACCATTTGTCTGTGAAATGTGTGCCAAAGCATTTACAACCCAGGCACATCTCAAGGAGCATTTAAAAATTCACACAGGCTATAAGCCTTACAGTTGTGAGGTTTGTGCAAAGTCTTTTATTCGTGCTCCAGATCTCAAAAAACATGAACGCGTCCACAGTAATGAGAGACCATTTGCGTGCCATCTTTGTGATAAAGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCTTCAGACCTAAAACGCCATGAAAACAACATGCATAGTGAGCAACGCAAACAAGTCACAACCAGTGCCATACAGAGTGAGACTGAGCAATTGCAGGCAGCAGCTATGGCAGCAGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATAACATACGCTGGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAACCAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCGATTAAATGTTCATTATTAAAGGATGTGAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ova1      in                         CABE7820.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAATTCGAGTATTTGCTGTATGGTCACAGAGAACAGTTTGCATGCCAAGCATGTGGCAAAACATTTACAGATGAAGCTCGTCTAAGAAAACATGAAAAGTTACACACAGCAGATAGACCATTTGTCTGTGAAATGTGTGCCAAAGCATTTACAACCCAGGCACATCTCAAGGAGCATTTAAAAATTCACACAGGCTATAAGCCTTACAGTTGTGAGGTTTGTGCAAAGTCTTTTATTCGTGCTCCAGATCTCAAAAAACATGAACGCGTCCACAGTAATGAGAGACCATTTGCGTGCCATCTTTGTGATAAAGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCTTCAGACCTAAAACGCCATGAAAACAACATGCATAGTGAGCAACGCAAACAAGTCACAACCAGTGCCATACAGAGTGAGACTGAGCAATTGCAGGCAGCAGCTATGGCAGCAGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATAACATACGCTGGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTNCATAGCCTCAGTGGTAAAAAA
  5   1   2       bld Gas1      in                     NISC_mq08e12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCATGCCAAGCATGTGGCAAAACATTTACAGATTTTTCTCCTCTAAGAAAACATGAAAAGTTACACACAGCAGATAGACCATTTGTCTGTGAAATGTGTGCCAAAGCATTTACAACCCAGGCACATCTCAAGGAGCATTTAAAAATTCACACAGGCTATAAGCCTTACAGTTGTGAGGTTTGTGCAAAGTCTTTTATTCGTGCTCCAGATCTCAAAAAACATGAACGCGTCCACAGTAATGAGAGACCATTTGCGTGCCATCTTTGTGATAAAGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCTTCAGACCTAAAACGCCATGAAAACAACATGCATAGTGAGCAACGCAAACAAGTCACAACCAGTGCCATACAGAGTGAGACTGAGCAATTGCAGGCAGCAGCTATGGCAGCAG
  5   1   2       bld Tad5                                 XZT61691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAACATGAACGCGTCCACAGTAATGAGAGACCATTTGCGTGCCATCTTTGTGATAAAGCATTCAAGCATAAATCTCATTTGAAAGACCATGAAAGAAGACACAGGGGTGAGAAACCTTTTATTTGTGCATCATGCACCAAAGCATTTGCCAAGGCTTCAGACCTAAAACGCCATGAAAACAACATGCATAGTGAGCAACGCAAACAAGTCACAACCAGTGCCATACAGAGTGAGACTGAGCAATTGCAGGCAGCAGCTATGGCAGCAGAGGCAGAACAGCAACTTGAAAGTATTGCCTGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAAACAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCANAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGNTAACCATGAAATTATTTTTAATTGCTTTTTAATTAGCCAACTTTAGG
  3   1   2      seed Te4       out                       CAAN11402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGCCAGCAGAGGCAGAACAGCAACTGGAAAGTATTGCCTGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAAACAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGCGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGTT
  3   1   2       bld Ova1      in                         CABE7820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCAGCTAAAGGAAAAATCATTACTTTATTTATCAGTCAATCTGTAATTTAAACAGCTGTATTTTGCACCTGAATGATAATGGTTTAGACTTCACACCCAAAATATCCCATATCTAGAGAGAGAAAAGTCATATGTACAGAATAACATACGCTGGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAAACAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGTGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGTT
  5  -1   2       bld Neu                            TNeu021k23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCATATGTACAGAATAACATACGCTGGAATTGCCAATTCTGCCTATACATTAACTCAACAGAATGANAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAAACAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGTGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGTTAAAAAAAAAAAAAAAAG
  3  -1   2       bld Gas5                                  XZF1984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCGCTGCAGCGCTGCAGCGCTGCAGCGCCAATTCTGCCTATACATTAACTCAACAGAATGAAAGCTTCTTGGTGCTTGATTTGCTCAATAGCCTCAGTGGTAAAAAAACCAAAAAACCAAAATGATATTGGTTTAACTTTTTTACCTTGAATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGCGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGTTAANAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas1      in                     NISC_mq08e12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATATTGTACATACTTTGTTTAAAATCAATTAAATGTTCATTATTAAAGGATGTTGTAAACATTAATTTTTGTAATGTGGCTAAATGTTGGAAGCAGGTTCAGGTTTTACTTTACAAAAGTAAAGGGATTGGCAGTTCTTGCATAAGCCTTACTGTGTGAATAGCAAAGCTATTGTAAATTAAGTGAGTAGCTTGTTTTATCATCAGCCTGTTAACCATGAATTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCCCAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGCGCTTACATCCTGCTTAAACTACATCTTCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCATGGGTGTTTTGTATTTTTAAAATAAAAGTGAACATTGGGAAAAAAAAAAAAAAACCAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA024a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTATTTTTAATTGCTTTTTAAATTAGCCAACTTTAGGTCCTCACAGATGAATGTCCTTTAATGACTAATATATTAAATGTAGTGCTTACATCCTGCTTAAACTACTTCTCCCCCCAACAAGGTTTGTATAGACCTCTACTTAGATGTAATAATGATTGCCTATTAAACTTCTTGTATAGGAAATGTACTACGTATATGTACTACATATATTTAGTATGCAGCACTCTATCTACATTTTGGCAGTGGGTGTTTTGTATTTTTAAAATAAAAGNTGAACATTGTTAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)