Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG38780.5                           35 END     1           9        2                FLJ20202 protein [Homo sapiens]

 This cluster: approximate FL confidence score = 96%

 1012088037 Xt7.1-XZG3577.5 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-XZG3577.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTATAGAACCGGCGGGATACAACGCATTTCACTGCACAGGAAGTTGCAAGCAACCCAAGTACCCCTTGTCCCATTATCACTATGGGCAGCGAACGTGCGCTGTGGTGGAAAGCGCCCCGCTGCCCGTCATGTACCTGGTCAAAAAGGGCGACTACACGGAAATCGAAGTGGCGGAATTCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAA
                                                  Xt7.1-CHK-1008235143                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTATAGAACCGGCGGGATACAACGCATTTCACTGCACAGGAAGTTGCAAGCAACCCAAGTACCCCTTGTCCCATTATCACTATGGGCAGCGAACGTGCGCTGTGGTGGAAAGCGCCCCGCTGCCCGTCATGTACCTGGTCAAAAAGGGCGACTACACGGAAATCGAAGTGGCGGAATTCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     3
                                               BLH ATG      37    1055                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      37     134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      37     179                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      37      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      37      10                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-013     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-013     NP_651942.2 CG11062-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 4e-018     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 8e-019     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ----------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 2e-018     AAI35711.1 Unknown (protein for IMAGE:7625732) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 2e-042     XP_782698.2 PREDICTED: similar to antivin/lefty [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ==== 5e-063     NP_034224.1 endometrial bleeding associated factor [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ==== 4e-067     NP_003231.2 endometrial bleeding associated factor preproprotein; transforming growthfactor, beta-4 (endometrial bleeding-associated factor; LEFTY A) [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 2e-070     BAB68348.1 lefty/antivin related protein [Ciona savignyi] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ==== 2e-073     BAE06534.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Gg ---- 8e-116     NP_990095.1 lefty [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 3e-140     NP_571035.1 lefty1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          AAG10035.1 TGF-beta family member lefty-B [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 0          NP_001082043.1 TGF-beta family member lefty-B [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZG3577.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------ATG------------------TGA------------------------------------------------------------TAA---------------------------------------------------------------TGA---------------------TGA------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------TAA---ATG---TAATGA---------------------------------------------------------------TAA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   1           Gas  FL                     TGas052n03.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGAAAGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTATAGAACCGGCGGGATACAACGCGTTTCACTGCACAGGAAGTTGCAAGCAACCCAAGTTCCCCTTGTCCCATTATCACTATGGGCAGCGAACGTGCGCTGTGGTGGAAAGCGCCCCGCTGCCCGTCATGTACCTGGTCAAAAAGGGCGACTACACGGAAATCGAAGTGGCGGAATTCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAAAAAAAAAAAAAAA
  5   1   2   22  bld Gas7 5g                               XZG9158.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGGAGTGAAAGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTACTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCCGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAGACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCCACCTGGATGAGCA
  5   1   2       bld Gas  FL   in                   TGas052n03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGCTGGAGGAGCTTTGACGTGACCCAGCTGTGCAGTACT
  5   1   2       bld TbA  5g3  in                   TTbA013i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAGGCACTTGCACCCTGATCACTGTCTCAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCCGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAAACATTCATTAACTTC
  5   1   2       bld Gas                            TGas031a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAAGGCCTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAACTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAGACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCANGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCT
  5   1   2   12 skin Gas7 PIPE in                          XZG3577.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGGACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTAT
  3   1   2       bld TbA  5g3  in                    TTbA013i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTATAGAACCGGCGGGATACAACGCATTTCACTGCACAGGAAGTTGCAAGCAACCCAAGTACCCCTTGTCCCATTATCACTATGGGCAGCGAACGTGCGCTGTGGTGGAAAGCGCCCCGCTGCCCGTCATGTACCTGGTCAAAAAGGGCGACTACACGGAAATCGAAGTGGCGGAATTCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTGAAAAAAAAAAAAAAAAAAGCG
  3   1   2      seed Gas7 PIPE in                          XZG3577.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATTCCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGGAG
  3   1   2       bld Gas  FL   in                    TGas052n03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTANATCAAACAATAAAGTTTTGATGAAATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                         CBXT4511.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT4511.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAAAAAAAAAAAA
  3   1   2       bld Gas       out                   TGas052n01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACGTTTTTTCCCGGCGCAAAATTTTACCGCTCCCCCCGGGAGTTTGTAAAAAAGAAAAAAGCAGCGCCGATTTTCAATCTTAGTAATGTCTGTGGCAGAACGATAGACGCATTTAGAGAAGCACTTCCCTGTAAATAGACTGATACAGATATTTATCTCTTGTTGACCCAGCCAACATTGCGGTGTGGAGATGGCTCATAAAATATGAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)