Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG38780.5                           35 END     1           9        2                FLJ20202 protein [Homo sapiens]

 This cluster: approximate FL confidence score = 96%

 1012088037 Xt7.1-XZG3577.5 - 11 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     3
                                               BLH ATG      37    1055                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      37     134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      37     179                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      37      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      37      10                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-013     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 2e-013     NP_651942.2 CG11062-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 4e-018     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 8e-019     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ----------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 2e-018     AAI35711.1 Unknown (protein for IMAGE:7625732) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 2e-042     XP_782698.2 PREDICTED: similar to antivin/lefty [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Mm ==== 5e-063     NP_034224.1 endometrial bleeding associated factor [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ==== 4e-067     NP_003231.2 endometrial bleeding associated factor preproprotein; transforming growthfactor, beta-4 (endometrial bleeding-associated factor; LEFTY A) [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 2e-070     BAB68348.1 lefty/antivin related protein [Ciona savignyi] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ==== 2e-073     BAE06534.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Gg ---- 8e-116     NP_990095.1 lefty [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 3e-140     NP_571035.1 lefty1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          AAG10035.1 TGF-beta family member lefty-B [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === ?? ==== 0          NP_001082043.1 TGF-beta family member lefty-B [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-XZG3577.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------------------------ATG------------------TGA------------------------------------------------------------TAA---------------------------------------------------------------TGA---------------------TGA------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------TAA---ATG---TAATGA---------------------------------------------------------------TAA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2   22  bld Gas7 5g                               XZG9158.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGGAGTGAAAGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTACTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCCGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAGACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCCACCTGGATGAGCA
  5   1   2       bld Gas  FL   in                   TGas052n03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGCTGGAGGAGCTTTGACGTGACCCAGCTGTGCAGTACT
  5   1   2       bld TbA  5g3  in                   TTbA013i08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAGGCACTTGCACCCTGATCACTGTCTCAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCCGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAAACATTCATTAACTTC
  5   1   2       bld Gas                            TGas031a08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAAGGCCTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAACTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAGACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCANGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCT
  5   1   2   12 skin Gas7 PIPE in                          XZG3577.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGCACTTGCACCCTGATCACTGTCACAGCAAGATGGGTGTCACTAGCACATGTCTCTGCCTGATCCTCAGCACCCTGTGCCTGGCTGCCAGCAGCGCCTTCAGCCCCGACCATATCCGAGATGCTCTGCTCAGAAAACTCAACCTCCAGGAGCCCCCCAAGCTGGAGAAAAGGGACGTGGAGAAGCTGCTGATCCCCAGGCACATCCAAGCCAAGTACATGTCTATGCTTCATACTCACAGGGAGAGGAAGAGGAGATCCCTGCCCAGCTTGGCTGGCATCCTCAGGGGCATCTCTGGCAACGCAGATATTGCCGGGGAGATTGTGTATTCAGACTCCAGCAAGCAAACCTTGGTGTTTGGAATGGAGTCCCGAATCCCAGAGAACAGTGAGGTGACTATGGCTGAACTCAAGCTCTTCAAGAAACCCCCCCAAATCATGAACGTCCCAGAGAGGAGATTCCACCGACCGGTCAATAACGCCAGAGTCAGTGTGTACTATGTGGAGATGCTCACAGATGGGACCAACAGAACCTCCCTGGTGGACTCTAGGCTTGTGCCCATCATGGAGTCGGGCTGGAGGAGCTTTGACGTGACCCAGGCTGTGCAGTACTGGACAAGGAGCGGGGGGCAGTCACCGATGCACTTAGAGATCCGGGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGGACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTAT
  3   1   2       bld TbA  5g3  in                    TTbA013i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGGATGGGGAGCGACATGGAAGTCATGCGTCTGAGATGGCAAAGTTGGTTCGTTTCACCACCCAGAGCGCTTCGGATAACTCTCTGGGGAAACCAGAACTTGTTCTATACACACTCAACCTGGATGAGCATGGGGCCCGCGGCGACTGCTCGGCATCAGGTGCCCAAAAAGACCACATCTGCTGCAGGGAGGAACATTTCATTAACTTCCGGGAGCTTACCTGGACACAGTACTGGATTATAGAACCGGCGGGATACAACGCATTTCACTGCACAGGAAGTTGCAAGCAACCCAAGTACCCCTTGTCCCATTATCACTATGGGCAGCGAACGTGCGCTGTGGTGGAAAGCGCCCCGCTGCCCGTCATGTACCTGGTCAAAAAGGGCGACTACACGGAAATCGAAGTGGCGGAATTCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTGAAAAAAAAAAAAAAAAAAGCG
  3   1   2      seed Gas7 PIPE in                          XZG3577.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATTCCCCCAATATGATAGTTGAAAAATGCGGTTGCACCATGGACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGGAG
  3   1   2       bld Gas  FL   in                    TGas052n03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAATATCGCTATCATATGATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTANATCAAACAATAAAGTTTTGATGAAATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                         CBXT4511.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT4511.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTGGTGGTGTGTGTAGTACTTGCAAATGTGCTCTTAGTAACCAGGCAGGGGCCCATTATATAAAGTGGCACCTTTGGGCCCCTCCAGCTGTCAAGAGGGTGCTGGGAGTTGTGCTTTAACACCAACTGAAGGGATGCAGTTTGGGCAAACTGATGTAATGCGTTAGTATTGCCACTTTTCCCTACTATCACCATCATGCCCTACTACTATAGTAACTACTATAGGTGCAGCTGCACGTTCAGACTTTTTCTGCTTAAACGAGACGTGCAGTCGCCCCTGTTTGCACCCACCCCGAGGCAGCTCTGTCAGTAACCGAACCGTAAGCCCACGGTTTTACCCAGCGCAAAATCTTACCGCTCCCCCCGGGAGTTTGTAAAAAAAAAAAAAGCAGCGACGATTTACAATCTTAGTAATGTCTGTGGCAGAACGATAGAAGCATTTAGAGAAGCACTTACCTGTAAATAGACTGATATAGATATTTATCTCTTGTTGACCCAGCCAACACTGCGGCGTGGAGATGGCTCATAAAATATGAATTAATGACGGAGGTATTTCTATTGGAAGATCGTTTCAGCATCATTTTTCAATTCTATATATATATATATATAATGGAAAGTTTAATCAAACAATAAAGTTTGTGATGAAATTAAAAAAAAAAAAAAA
  3   1   2       bld Gas       out                   TGas052n01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACGTTTTTTCCCGGCGCAAAATTTTACCGCTCCCCCCGGGAGTTTGTAAAAAAGAAAAAAGCAGCGCCGATTTTCAATCTTAGTAATGTCTGTGGCAGAACGATAGACGCATTTAGAGAAGCACTTCCCTGTAAATAGACTGATACAGATATTTATCTCTTGTTGACCCAGCCAACATTGCGGTGTGGAGATGGCTCATAAAATATGAAT

In case of problems mail me! (