Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 29%

 1012088095 Xt7.1-CAAO8080.3 - 10 ESTs
                                                                       ....-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO8080.3                                                                                                                                                                                         TCGCCACACGCGAACGGCACGAGTCCCGCTGCCTCCTGCCCAGCCGCCCCCTCCTGCCCAGCATGGACAACTCCGCTGCCAACATCATGGAGAGCAACTTGTCCGGCCAGCAGCAGCAGCATTTCCTACAGCCCGCTTGCTTCTTCCCGCAGAACGTCCAGCTGAGCCCGGCGGAGGAGCACGAAGCGGCCAAACCCAAGCAGATCAAGCGGCAGCGCTCGTCCTCCCCGGAGCTGATGAGGTGCAAGAGGCGCCTGAACTTCACCGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGGGTCAAGCTGGTCAATTTGGGTTTTGCCACTCTGAGGGAACACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAAACGCTGCGATCTGCAGTAGAGTACATCAGGGCGCTGCAACAGTTGCTGGACGAACACGACGCTGTCAGTGCAGCTTTCCAGTCCGGCGTTCTTTCCCCCACCATCTCCCCCAACTATTCCCACGATATGAACTCTATGGCGGGGTCCCCCGTCTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGCTGAGCCCGGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTGAGATATTGAGAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCTCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGATGGATAGAGACATAATTCAGTGGGAGTCGTGGGTGGTGAAGCACACAGACACCATCCCAGCTCACACGTGGAAGAGACGTGGTCCGTATGAACAACCTGGGGCCTACCCCAAATAAAACGCAAGCCCTTATTGACTGTACCCTCCTTCTTTTCGATGGAGACCGTTCTCGGATCAGATTTGTGGAGTTTCTATCCCAAACTATGCTGTTATTCAAAGAACCCCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGTTGGAATTCCTACAGATGTACTTTAGCACCAACGTGTCTTACTTTATAGAAACTTTGTTAATGTATTAATTGTGTTATTAAACAATGTTCACAGTGAACAAAGTTTATGCAGCTATTGTCCAAACGCAAAATAGTGGTCCACTGTATTTATGCTGCCTTTTGGAACCCTATATACCACTGCCTTTTTTTACTGTTTTTAATACAAACTTACAAATGTCCTGCATAAATATGTTTTTTACACAATAGTTTCATAATAAAACATTTTTA
                                                  Xt7.1-CHK-1008236111                                                                                                                                                                                               CACGCGAACGGCACGAGTCCCGCTGCCTCCTGCCCAGCCGCCCCCTCCTGCCCAGCATGGACAACTCCGCTGCCAACATCATGGAGAGCAACTTGTCCGGCCAGCAGCAGCAGCATTTCCTACAGCCCGCTTGCTTCTTCCCGCAGAACGTCCAGCTGAGCCCGGCGGAGGAGCACGAAGCGGCCAAACCCAAGCAGATCAAGCGGCAGCGCTCGTCCTCCCCGGAGCTGATGAGGTGCAAGAGGCGCCTGAACTTCACCGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGGGTCAAGCTGGTCAATTTGGGTTTTGCCACTCTGAGGGAACACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAAACGCTGCGATCTGCAGTAGAGTACATCAGGGCGCTGCAACAGTTGCTGGACGAACACGACGCTGTCAGTGCAGCTTTCCAGTCCGGCGTTCTTTCCCCCACCATCTCCCCCAACTATTCCCACGATATGAACTCTATGGCGGGGTCCCCCGTCTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGCTGAGCCCGGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTGAGATATTGAGAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCTCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGATGGATAGAGACATAATTCAGTGGGAGTCGTGGGTGGTGAAGCACACAGACACCATCCCAGCTCACACGTGGAAGAGACGTGGTCCGTATGAACAACCTGGGGCCTACCCCAAATAAAACGCAAGCCCTTATTGACTGTACCCTCCTTCTTTTCGATGGAGACCGTTCTCGGATCAGATTTGTGGAGTTTCTATCCCAAACTATGCTGTTATTCAAAGAACCCCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGTTGGAATTCCTACAGATGTACTTTAGCACCAACGTGTCTTACTTTATAGAAACTTTGTTAATGTATTAATTGTGTTATTAAACAATGTTCACAGTGAACAAAGTTTATGCAGCTATTGTCCAAACGCAAAATAGTGGTCCACTGTATTTATGCTGCCTTTTGGAACCCTATATACCACTGCCTTTTTTTACTGTTTTTAATACAAACTTACAAATGTCCTGCATAAATATGTTTTTTACACAATAGTTTCATAATAAAACA
                                                      consensus depths                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     4     5     5     5     5     5     5     5     5     5     4     4     5     5     5     5     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4
                                               BLH ATG      62      43                                                                                                                                                                                         
                                               BLH MIN      38      68                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 2e-007     ABD57444.1 Mesp [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 6e-008     AAI35784.1 Unknown (protein for MGC:121737) [Xenopus tropicalis] ------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 6e-012     NP_495938.3 Helix Loop Helix family member (hlh-3) [Caenorhabditis elegans] -------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN === Ci ==== 3e-016     BAE06314.1 transcription factor protein [Ciona intestinalis] ============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 1e-017     NP_476623.1 CG3839-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 1e-039     XP_797956.1 PREDICTED: similar to Achaete-scute homolog 1 (HASH1) [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 3e-081     NP_989743.1 achaete-scute complex-like 1 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PROTEIN --- Mm ---- 3e-082     NP_032579.2 achaete-scute complex homolog-like 1; mammalian achaete scute homolog 1 [Musmusculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 5e-083     NP_004307.2 achaete-scute complex homolog-like 1 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 7e-084     NP_571294.1 achaete-scute complex-like 1a [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 2e-098     AAA49649.1 achaete-scute homologue [Xenopus laevis]  ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 2e-098     NP_001079247.1 achaete-scute complex-like 1 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO8080.3                                                                                                                                                                                                                                                       ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------TGA------------------------------------TAA------------------------------------------TGA---------------------TAG---------------TAG---------------------------------------------------------------------------------TGA---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG---TAA---ATG------------------------ATG---------------------------TAG---------------------------ATG------------------------TAA------------------------------TAG---------------------------------------------------------------------------------------------------------TAG---------------ATG---------------------------------------------TAA---------------------------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Te5       in                        CAAO10506.5p CGCCAGCGGCAGGGCAGTAGCAGCATTGAGTGCGCACAGTTAGAGCCAGGGAACGTGCAGGGCTGCTCCTGTCACAGTGTCAGTGCTACAGTGTCAGTCCCACAGCAGCCCCATCAGCAGCCCCTACAGCAGCCTCACACTCCCTCACACTCCCTCACACACCGCCGCCTCCTCACCCACAGGCTCGCCACACGCGAACGGCACGAGTCCCGCTGCCTCCTGCCCAGCCGCCCCCTCCTGCCCAGCATGGACAACTCCGCTGCCAACATCATGGAGAGCAACTTGTCCGGCCAGCAGCAGCAGCATTTCCTACAGCCCGCTTGCTTCTTCCCGCAGAACGTCCAGCTGAGCCCGGCGGAGGAGCACGAAGCGGCCAAACCCAAGCAGATCAAGCGGCAGCGCTCGTCCTCCCCGGAGCTGATGAGGTGCAAGAGGCGCCTGAACTTCACCGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGGGTCAAGCTGGTCAATTTGGGTTTTGCCACTCTGAGGGAACACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAAACGCTGCGATCTGCAGTAGAGTACATCAGGGCGCTGCAACAGTTGCTGGACGAACACGACGCTGTCAGTGCAGCTTTCCAGTCCGGCGTTCTTTCCCCCACCATCTCCCCCAACTATTCCCACGATATGAACTCTATGGCGGGGTCCCCCGTCTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGC
  5   1   2       bld TbA  5g3  in                   TTbA025k04.p1kSP6     CCCGGGGAATTCCCCGGGTTGAGTGCGCACAGTTAGAGCCAGGGAACGTGCAGGGCTGCTCCTGTCACAGTGTCAGTGCTACAGTGTCAGTCCCACAGCAGCCCCATCAGCAGCCCCTACAGCAGCCTCACACTCCCTCACACTCCCTCACACACCGCCGCCTCCTCACCCACAGGCTCGCCACACGCGAACGGCACGAGTCCCGCTGCCTCCTGCCCAGCCGCCCCCTCCTGCCCAGCATGGACAACTCCGCTGCCAACATCATGGAGAGCAACTTGTCCGGCCAGCAGCAGCAGCAGCATTTCCTACAGCCCGCTTGCTTCTTCCCGCAGAACGTCCAGCTGAGCCCGGCGGAGGAGCACGAAGCGGCCAAACCCAAGCAGATCAAGCGGCAGCGCTCGTCCTCCCCGGAGCTGATGAGGTGCAAGAGGCGCCTGAACTTCACCGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGGGTCAAGCTGGTCAATTTGGGTTTTGCCACTCTGAGGGAACACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAAACGCTGCGATCGGCAGTAGAGTACATCAGGGCGCTGCAACAGTTGCTGGACGAACACGACGCTGTCAGTGCAGCTTTCCAGTCCGGCGTTCTTTCCCCCACCATCTCCCCCAACTATTCCCACGATATGAACTCTATGGCGGGGTCCCCCGTTTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGCTGAGCCCGGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTG
  5   1   2       bld Te5       in                         CAAO8080.5p                                                                                                                                                                                       GCTCGCCACACGCGAACGGCACGAGTCCCGCTGCCTCCTGCCCAGCCGCCCCCTCCTGCCCAGCATGGACAACTCCGCTGCCAACATCATGGAGAGCAACTTGTCCGGCCAGCAGCAGCAGCATTTCCTACAGCCCGCTTGCTTCTTCCCGCAGAACGTCCAGCTGAGCCCGGCGGAGGAGCACGAAGCGGCCAAACCCAAGCAGATCAAGCGGCAGCGCTCGTCCTCCCCGGAGCTGATGAGGTGCAAGAGGCGCCTGAACTTCACCGGCTTCGGCTACAGCCTCCCGCAGCAGCAACCGGCCGCCGTGGCCCGGAGGAACGAGAGGGAGAGGAACCGGGTCAAGCTGGTCAATTTGGGTTTTGCCACTCTGAGGGAACACGTCCCCAACGGTGCGGCCAACAAGAAGATGAGCAAAGTGGAAACGCTGCGATCTGCAGTAGAGTACATCAGGGCGCTGCAACAGTTGCTGGACGAACACGACGCTGTCAGTGCAGCTTTCCAGTCCGGCGTTCTTTCCCCCACCATCTCCCCCAACTATTCCCACGATATGAACTCTATGGCGGGGTCCCCCGTCTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGCTGAGCCCGGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTGAGATATTGAGAGCAGGCTGTTTGCCTCCCTGCTTGGATAACANAGTGAAGCTCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGATGGATAGAGACATAATTCAGTGGGAGTCG
  5   1   2       bld HdA       in                   THdA034h13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACGCTGTCAGTGCAGCTTTCCAGTCCCGTTTTCTTTCCCCCACCATCTCCCCCAACTATTCCCACGATATGAACTCTATGGCGAGGGTCCCCCGTCTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGCTGAGCCCGGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTGAGATATTGAGAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCTCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGATGGATAGAGACATAATTCAGTGGGAGTCGTGGGTGGTGAAGCACACAGACACCATCCCAGCTCACACGTGGAAGAGACGTGGTCCGTATGAACAACCTGGGGCCTACCCCAAATAAAACGCAAGCCCTTATTGACTGTACCCTCCTTCTTTTCGATGGAGACCGTTCTCGGATCAGATTTGTGGAGTTTCTATCCCAAACTATGCTGTTATTCAAAGAACCCCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTAT
  5  -1   2       bld TbA       out                  TTbA002j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATATGAACTCTATGGCGGGGTCCCCCGTTTCCTCTTACTCATCAGATGAAGGCTCGTATGATCCGCTGAGCCCGGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTGAGATATTGAGAGCAGGTGAGTTGGCTCTATCCATACACACTGACTGCCCAGCATCCAGCCTGGACCACTCTGTCGGGAAGGGTGACACTTCCATAGCAACTGGGCGCAGTCACATCTAGAGGCCACTCTTTTATTGCTTTCTATTTAGATCAGCCAGTGCTTGATAAAACTGATTTTAGACCTGTCATCCAACAGTTGCCAGGAAAGTGGAAGTTTTAGTTCAGCAGCAGTAGGAGGGTTGCAAGTTTCCTATCTACCAATGAAAAAAGATTGACTTTTGCATCTACCTTAGCAATTACACTCAACTCTCCTAATTTACCATTTCCCAGCCTCAGGCAGGAAAATATTGGGTTTTTAAAACAATTCTTGAGCATGTTGATCAGCCTTGAGTAGTTTTGTGCTCATCTAACAGGAAGATAGGCTGTGGCGTCCTTTAAATTAATTATATAGTTAAAGTAATTCCTATTATAGGCTTTGCACAATTACAGCATTGCTTTGCTTTCATACATGAGTCTGGTGTGGAGCATTTCACTGACAATGTGCTAAATTGTCTCAGTAAATATGGCAGAACTGTGTCTGTGGTGGGGATTGCCTGAGCCATATGTGATGTCAACAAGTCCCTTCTGTATACTGATCTTTTGTATTGTTCTTTCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCTCACAGGAGCAG
  5   1   2       bld Tbd1      out                        CBXT9214.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGGAGCAGGAGCTGCTCGACTTCACCACTTGGTTCTGAGATATTGAGAGCAGGCTGTTTGCCTCCCTGCTTGGATAACAAAGTGAAGCTCACAGGAGCAGTCGGTCCCTCCAAGAACACTGAAGCACTACATTTGCACTCCAGTAGGATTCACTGGATGGATAGAGACATAATTCAGTGGGAGTCGTGGGTGGTGAAGCACACAGACACCATCCCAGCTCACACGTGGAAGAGACGTGGTCCGTATGAACAACCTGGGGCCTACCCCAAATAAAACGCAAGCCCTTATTGACTGTACCCTCCTTCTTTTCGATGGAGACCGTTCTCGGATCAGATTTGTGGAGTTTCTATCCCAAACTATGCTGTTATTCAAAGAACCCCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTATCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGT
  3   1   2       bld Te5       in                         CAAO8080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAGAGACATATTTCAGTGGGAGTCGTGGGTGGTGAAGCACACAGACACCATCCCAGCTCACACGTGGAAGAGACGTGGTCCGTATGAACAACCTGGGGCCTACCCCAAATAAAACGCAAGCCCTTATTGACTGTACCCTCCTTCTTTTCGATGGAGACCGTTCTCGGATCAGATTTGTGGAGTTTCTATCCCAAACTATGCTGTTATTCAAAGAACCCCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGTTGGAATTCCTACAGATGTACTTTAGCACCAACGTGTCTTACTTTATAGAAACTTTGTTAATGTATTAATTGTGTTATTAAACAATGTTCACAGTGAACAAAGTTTATGCAGCTATTGTCCAAACGCAAAATAGTGGTCCACTGTATCTATGCTGCCTTTTGGAACCCTATATACCACTGCCTTTTCTTACTGTTTTTAATACAAACTTACAAATGTCCTGCATAAATATGTTTTTTACACAATAGTTTCATAATAAAACATTTTTATATGG
  3   1   2      seed Te5       in                        CAAO10506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTCACACGTGGAAGAGACGTGGTCCGTATGAACAACCTGGGGCCTACCCCAAATAAAACGCAAGCCCTTATTGACTGTACCCTCCTTCTTTTCGATGGAGACCGTTCTCGGATCAGATTTGTGGAGTTTCTATCCCAAACTATGCTGTTATTCAAAGAACCCCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGTTGGAATTCCTACAGATGTACTTTAGCACCAACGTGTCTTACTTTATAGAAACTTTGTTAATGTATTAATTGTGTTATTAAACAATGTTCACAGTGAACAAAGTTTATGCAGCTATTGTCCAAACGCAAAATAGTGGTCCACTGTATCTATGCTGCCTTTTGGAACCCTATATACCACTGCCTTTTCTTACTGTTTTTAATACAAACTTACAAATGTCCTGCATAAATATGTTTTTTACACAATAGTTTCATAATAAAACATTTTTATATGG
  3   1   2       bld HdA       in                    THdA034h13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCCTTCAGACTCTACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGTTGGAATTCCTACAGATGTACTTTAGCACCAACGTGTCTTACTTTATAGAAACTTTGTTAATGTATTAATTGTGTTATTAAACAATGTTCACAGTGAACAAAGTTTATGCAGCTATTGTCCAAACGCAAAATAGTGGTCCACTGTATTTATGCTGCCTTTTGGAACCCTATATACCACTGCCTTTTTTTACTGTTTTTAATACAAAACTTACAAAATGTCNCTGCATAAATATGTTTTTTACACAGATAGTTTCATAATAAAACATTTTTATAGGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA025k04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCCCTATTTTTTTGTACCACTTTCCTCTTCAAATGCTTCCAATCTTTTGTGAATTTTTTTATTATAAGAAATATTTCTATCTGTCCCATCTGTTTTGGGATATATTAAGCTATTTTTGTACATAAGAGAGAGATTTATAGAAGTTTTGTACAAATGGTATAAAATATGTATATCTTGATACATTATTATGTAATGCTTATTACCTCTGCATATTTAGACTTGTAGTCTATAACCTTACAACTGCAATTTTGTATGTGGTTTTGTAAAGGACACTCCTTTTAAGGTGGGGTTGGAATTCCTACAGATGTACTTTAGCACCAACGTGTTTTACTTTATAGAAACTTTGTTAATGTATTAATTGTGTTATTAAACAATGTTCACAGTGAACAAAGTTTATGCAGCTATTGTCCAAACGCAAAATAGTGGTCCACTGTATTTATGCTGCCTTTTGGAACCCTATATACCACTGCCTTTTTTTACTGTTTTTAATACAAACTTACAAATGTCCTGCATAAATATGTTTTTTACACAATAGTTTCATAATAAAACATTTTTATATGAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)