Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 89%

 1012088153 Xt7.1-CABK5596.3 - 13 ESTs
                                                                       .........-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK5596.3                                                                                                                                                                                                                                                                                                                      CCATCTCCATCTACATGAAATGTCATGTCTGGTATATTCTATGGAAACATGAGAAAAATGGGATCTTCTCTGTTCATCATCACCTTCTTACTGCTTAACTGCTGCAGTCAGGCCAACTCCATAACAGTAAATTGTATCGTGACGCAGGAGAAATCCATGACATGCATGTGGAACAAAGAAGCACTGTCTCCTGAGAACTATTCCCTTTACTACTGGTACACGTCGGATGGAAATACGACAGCTGCACCATGCACTCGCTACCTACAGGAGAATGGGATCAATATAGGCTGCTGGTTCAACTCATCTGCTGTCAGAACTTTTAAAGAATTCAATGTGAGACTGAACAGCAGCAGCAAACAGGAGCATGTACAACGTTTTCGGAACCTGCAAAATTTGGTTAGGCTGGAGCCTCCTGTTAAGCTGCATGTAGAGAACAGAAGTGACTTGGAGCTTCTTCTGAGCTGGGAGCCATTGCTTGGCCAATTCAAGGACCACTGTCTCACTTACCAGGTGCAATATCGCAGCCTGGCCAGCAACTCATGGACGGTGAAGAATGTTACTATCAAACAGTTTTCCTTACCAAGCTATAGCCGTGACAAGCTCTACACATTTCACGTGAGAAGCAAATTGAACGAATTGTGTGCCTCCACTGTTTTGTGGAGCGAGTGGAGTGTAGGTGTTTCCTGGGGCAGAAATGACACAACTCCCAGCAAAGAGACATCCTTTCCTTTCAAAACCATTGCTAGCGTTGGATTTCCCATTGTGTTTTTCTTCCTAGTGGTTCTGTTTATCCGCACAGAGCGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCCGAGAAGAATTTCCAGGATCTTTACAAAATATTCAACGGTGACTTCCAGGAATGGACTGGCGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATACCTATACGGAGCCCTTATGCAGCGTCTGCGAGGACACAGAATGCACAGTGGCAGAGATCAAGAAGCCTCCACCCACCTGAAGCAACTGGGATTGGGGACTGGGGACTGGAGTTGAGGAAAACAATGTAATAGAGAATAGATTCGTTCTGAGGGGCCCAGTTCTATATGTGTGTGTATATATATATATACAAAGAAGTAATGGACTCACTTGTGGTGTTGTGGAGAAAATGTCTTTGCTTTGTTAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACCGTTGTCAGGATGCGCATCTCTTGAGGATTGAAACTGCACTATTTTGCCTTTGATGAAGTGGGGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCACTTCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCACTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTGCACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGTACATATTTTTACCACATGAATCTTATATGTAATTAAATGTATTTT
                                                  Xt7.1-CHK-1008233979                                                                                                                                                                                                                                                                                                                            CCATCTACATGAAATGTCATGTCTGGTATATTCTATGGAAACATGAGAAAAATGGGATCTTCTCTGTTCATCATCACCTTCTTACTGCTTAACTGCTGCAGTCAGGCCAACTCCATAACAGTAAATTGTATCGTGACGCAGGAGAAATCCATGACATGCATGTGGAACAAAGAAGCACTGTCTCCTGAGAACTATTCCCTTTACTACTGGTACACGTCGGATGGAAATACGACAGCTGCACCATGCACTCGCTACCTACAGGAGAATGGGATCAATATAGGCTGCTGGTTCAACTCATCTGCTGTCAGAACTTTTAAAGAATTCAATGTGAGACTGAACAGCAGCAGCAAACAGGAGCATGTACAACGTTTTCGGAACCTGCAAAATTTGGTTAGGCTGGAGCCTCCTGTTAAGCTGCATGTAGAGAACAGAAGTGACTTGGAGCTTCTTCTGAGCTGGGAGCCATTGCTTGGCCAATTCAAGGACCACTGTCTCACTTACCAGGTGCAATATCGCAGCCTGGCCAGCAACTCATGGACGGTGAAGAATGTTACTATCAAACAGTTTTCCTTACCAAGCTATAGCCGTGACAAGCTCTACACATTTCACGTGAGAAGCAAATTGAACGAATTGTGTGCCTCCACTGTTTTGTGGAGCGAGTGGAGTGTAGGTGTTTCCTGGGGCAGAAATGACACAACTCCCAGCAAAGAGACATCCTTTCCTTTCAAAACCATTGCTAGCGTTGGATTTCCCATTGTGTTTTTCTTCCTAGTGGTTCTGTTTATCCGCACAGAGCGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCCGAGAAGAATTTCCAGGATCTTTACAAAATATTCAACGGTGACTTCCAGGAATGGACTGGCGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATACCTATACGGAGCCCTTATGCAGCGTCTGCGAGGACACAGAATGCACAGTGGCAGAGATCAAGAAGCCTCCACCCACCTGAAGCAACTGGGATTGGGGACTGGGGACTGGAGTTGAGGAAAACAATGTAATAGAGAATAGATTCGTTCTGAGGGGCCCAGTTCTATATGTGTGTGTATATATATATATACAAAGAAGTAATGGACTCACTTGTGGTGTTGTGGAGAAAATGTCTTTGCTTTGTTAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACCGTTGTCAGGATGCGCATCTCTTGAGGATTGAAACTGCACTATTTTGCCTTTGATGAAGTGGGGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCACTTCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCACTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTGCACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGTACATATTTTTACCACATGAATCTTATATGTAATTAAATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                           2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     3     3     4     5     4     5     4     5     4     5     3     4     3     4     3     4     5     6     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     7     7     6     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4
                                               BLH MIN      24      34                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR      24      98                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG      24      14                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 1e-012     NP_001036799.1 erythropoietin receptor [Danio rerio] ---------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 5e-018     XP_697711.1 PREDICTED: similar to interleukin 13 receptor alpha-2 isoform 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 1e-037     NP_038591.1 interleukin 2 receptor, gamma chain [Mus musculus] -----------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 7e-041     NP_000197.1 interleukin 2 receptor, gamma precursor [Homo sapiens] -------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ==== 1e-059     NP_989858.1 putative common cytokine receptor gamma chain a [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 9e-150     AAI29717.1 Unknown (protein for IMAGE:8547895) [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK5596.3                                                                                                                                                                                                                                                                                                                                     TGA------ATG---------------------ATG------ATG------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAA------------------------------TGA---------------------------------------------------------------TGATGA---------------------------ATG---------------------------------------------------ATG---------------------------ATG------------------------------------TGAATG------------------------------------------------------------TAA------------------------------------------------------------------ATG------------------------------------------------------------------TAG---------------------------------------------------------TAA------------------------------TAA---------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2   10  bld Thy1 5g3  in                        CBST5227.fwd ...............................................................................................................................................................................................................................................................................................CACAAGCAGCATCCAAGAGCAGCCATCTCCATCTACATGAAATGTCATGTCTGGTATATTCTATGGAAACATGAGAAAAATGGGATCTTCTCTGTTCATCATCACCTTCTTACTGCTTAACTGCTGCAGTCAGGCCAACTCCATAACAGTAAATTGTATCGTGACGCAGGAGAAATCCATGACATGCATGTGGAACAAAGAAGCACTGTCTCCTGAGAACTATTCCCTTTACTACTGGTACACGTCGGATGGAAATACGACAGCTGCACCATGCACTCGCTACCTACAGGAGAATGGGATCAATATAGGCTGCTGGTTCAACTCATCTGCTGTCAGAACTTTTAAAGAATTCAATGTGAGACTGAACAGCAGCAGCAAACAGGAGCATGTACAACGTTTTCGGAACCTGCAAAATTTGGTTAGGCTGGAGCCTCCTGTTAAGCTGCATGTAGAGAACAGAAGTGACTTGGAGCTTCTTCTGAGCTGGGAGCCATTGCTTGGCCAATTCAAGGACCACTGTCTCACTTACCAGGTGCAATATCGCAGCCTGGCCAGCAACTCATGGACGGTGAAGAATGTTACTATCAAACAGTTTTCCTTACCAAGCTATAGCCGTGACAAGCTCTACACATTTCACGTGAGAAGCAAATTGAACGAATTGTGTGCCTCCACTGTTTTGTGGAGCGAGTGGAGTGTAGGTGTTTCCTGGGGCAGAAATGACACAACTCCCAGCAAAGAGACATCCTTTCCTTTCAAACCATTGCTAGCGT
  5   1   2   10  bld Spl1 5g3  in                         CABK3721.5p .....................................................................................................................................................................................................................................................................................................................CCATCTCCATCTACATGAAATGTCATGTCTGGTATATTCTATGGAAACATGAGAAAAATGGGATCTTCTCTGTTCATCATCACCTTCTTACTGCTTAACTGCTGCAGTCAGGCCAACTCCATAACAGTAAATTGTATCGTGACGCAGGAGAAATCCATGACATGCATGTGGAACAAAGAAGCACTGTCTCCTGAGAACTATTCCCTTTACTACTGGTACACGTCGGATGGAAATACGACAGCTGCACCATGCACTCGCTACCTACAGGAGAATGGGATCAATATAGGCTGCTGGTTCAACTCATCTGCTGTCAGAACTTTTAAAGAATTCAATGTGAGACTGAACAGCAGCAGCAAACAGGAGCATGTACAACGTTTTCGGAACCTGCAAAATTTGGTTAGGCTGGAGCCTCCTGTTAAGCTGCATGTAGAGAACAGAAGTGACTTGGAGCTTCTTCTGAGCTGGGAGCCATTGCTTGGCCAATTCAAGGACCACTGTCTCACTTACCAGGTGCAATATCGCAGCCTGGCCAGCAACTCATGGACGGTGAAGAATGTTACTATCAAACAGTTTTCCTTACCAAGCTATAGCCGTGACAAGCTCTACACATTTCACGTGAGAAGCAAATTGAACGAATTGTGTGCCTCCACTGTTTTGTGGAGCGAGTGGAGTGTAGGTGTTTCCTGGGGCAGAAATGACACAACTCCCAGCAAAGAGACATCCTTTCCTTTCAAAACCATTGCTAGCGTTGGATTTCCCATTGTGTTTTTCTTCCTAGTGGTTCTGTTTATCCGCACAGAGCGGATCTGGGTGATTCTAGTGCCTCA
  5   1   2       bld Spl1      in                         CABK5596.5p                                                                                                                                                                                                                                                                                                                                                     GTATATTCTATGGAAACATGAGAAAAATGGGATCTTCTCTGTTCATCATCACCTTCTTACTGCTTAACTGCTGCAGTCAGGCCAACTCCATAACAGTAAATTGTATCGTGACGCAGGAGAAATCCATGACATGCATGTGGAACAAAGAAGCACTGTCTCCTGAGAACTATTCCCTTTACTACTGGTACACGTCGGATGGAAATACGACAGCTGCACCATGCACTCGCTACCTACAGGAGAATGGGATCAATATAGGCTGCTGGTTCAACTCATCTGCTGTCAGAACTTTTAAAGAATTCAATGTGAGACTGAACAGCAGCAGCAAACAGGAGCATGTACAACGTTTTCGGAACCTGCAAAATTTGGTTAGGCTGGAGCCTCCTGTTAAGCTGCATGTAGAGAACAGAAGTGACTTGGAGCTTCTTCTGAGCTGGGAGCCATTGCTTGGCCAATTCAAGGACCACTGTCTCACTTACCAGGTGCAATATCGCAGCCTGGCCAGCAACTCATGGACGGTGAAGAATGTTACTATCAAACAGTTTTCCTTACCAAGCTATAGCCGTGACAAGCTCTACACATTTCACGTGAGAAGCAAATTGAACGAATTGTGTGCCTCCACTGTTTTGTGGAGCGAGTGGAGTGTAGGTGTTTCCTGGGGCAGAAATGACACAACTCCCAGCAAAGAGACATCCTTTCCTTTCAAAACCATTGCTAGCGTTGGATTTCCCATTGTGTTTTTCTTCCTAGTGGTTCTGTTTATCCGCACAGAGCGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCCGAG
  5   1   2       bld Spl1      in                         CABK6206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGCAACTCATGGACGGTGAAGAATGTTACTATCAAACAGTTTTCCTTACCAAGCTATAGCCGTGACAAGCTCTACACATTTCACGTGAGAAGCAAATTGAACGAATTGTGTGCCTCCACTGTTTTGTGGAGCGGGTGGAGTGTAGGTGTTTCCTGGGGCAGAAATGACACAACTCCCAGCAAAGAGACATCCTTTCCTTTCAAAACCATTGCTAGCGTTGGATTTCCCATTGTGTTTTTCTTCCTAGTGGTTCTGTTTATCCGCACAGAGCGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCCGAGAAGAATTTCCAGGATCTTTACAAAATATTCAACGGTGACTTCCAGGAATGGACTGGCGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATACCTATACGGAGCCCTTATGCAGCGTCTGCGAGGACACAGAATGCACAGTGGCAGAGATCAAGAAGCCTCCACCCACCTGAAGCAACTGGGATTGGGGACTGGGGACTGGAGTTGAGGAAAACAATGTAATAGAGAATAGATTCGTTCTGAGGGGCCCAGTTCTATATGTGTGTGTATATATATATATACAAAGAAGTAATGGACTCACTTGTGGTGTTGTGGGGAAAATGTCTTTGCTTTGTTAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACT
  5   1   2       bld Thy1      in                        CBST3631.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAGAGACATCCTTTCCTTTCAAACCATTGCTAGCGTTGGATTTCCCATTGTGTTTTTCTTCCTAGTGGTTCTGTTTATCCGCACAGAGCGGATCTGGGTGATTCTAGTGCCTCAGATTCCAAACCCCGAGAAGAATTTCCAGGATCTTTACAAAATATTCAACGGTGACTTCCAGGAATGGACTGGCGTTTCCAAAGATGTTGTGAAGAGTTTGAACCATACCTATACGGAGCCCTTATGCAGCGTCTGCGAGGACACAGAATGCACAGTGGCAGAGATCAAGAAGCCTCCACCCACCTGAAGCAACTGGGATTGGGGACTGGGGACTGGAGTTGAGGAAAACAATGTAATAGAGAATAGATTCGTTCTGAGGGGCCCAGTTCTATATGTGTGTGTATATATATATATACAAAGAAGTAATGGACTCACTTGTGGTGTTGTGGAGAAAATGTCTTTGCTTTGTTAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACCGTTGTCAGGATGCGCATCTCTTGAGGATTGAAACTGCACTATTTTGCCTTTGATGAAGTGAAGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTANAAATCAGCTGAGTGCTTGTGTTTG
  5   1   2       bld Thy1      in                        CBST6483.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGTCCGCCCGAGAAGAATTTCCAGGATCTTTACAAAATATTCCACGGTGACTTCCAGGAATGGACTGGCGTTTCCAAAGATGTTGTGCAGAGTTTGAACCATACCTATACGGAGCCCTTATGCAGCGTCTGCGAGGACACAGAATGCACAGTGGCAGAGATCAAGAAGCCTCCACCCACCTGAAGCAACTGGGATTGGGGACTGGGGACTGGAGTTGAGGAAAACAATGTAATAGAGAATAGATTCGTTCTGAGGGGCCCAGTTCTATATGT
  3   1   2       bld Spl1 5g3  in                         CABK3721.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACCCACCTGAAGCAACTGGGATTGGGGACTGGGGACTGGAGTTGAGGAAAACAATGTAATAGAGAATAGATTCGTTCTGAGGGGCCCAGTTCTATATGTGTGTGTATATATATATATACAAAGAGGTAATGGACTCACTTGTGGTGTTGTGAAGAAAATGTCTTTGCTTTGTTAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACCGTTGTCAGGATGCGCATCTCTTGAGGATTGAAACTGCACTATTTTGCCTTTGATGAAGTGGGGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCAAATCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCACTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGG
  3   1   2       bld Spl1      in                         CABK6206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGCTTTGTTAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACTGTTGTCAGGATGCGCATCTCTTGAGGATTGAAACTGCACTATTTTGCCTTTGATGAAGTAAAGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCACTTCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCACTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTACACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGTACATATTTTTACCACATGAATCTTATATGTAATTAAATGTATTTTAGC
  3   1   2      seed Spl1      in                         CABK5596.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAGGGCAAAATAGTGCAGACATTGACGTGTTTTGATCCTCTAGGGACCGTTGTCAGGATGCGCATCTCTTGAGGATTGAAACTGCACTGTTTTGCCTTTGATGAAGTGGGGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCAAATCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCACTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTGCACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGTACATATTTTTACCACATGAATCTTATATGTAATTAAATGTATTTTAGCAAAAATGCAATTCTTATTTCAT
  3   1   2       bld Thy1      in                        CBST3631.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATTGAAACTGCACTATTTTGCCTTTGATGAAGTGAAGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCACTTCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCCCTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTGCACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGTACATATTTTTACCACATGAATCTTATATGTAATTAAATGTATTTTAGC
  3   1   2       bld Thy1 5g3  in                        CBST5227.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTGCACTATTTTGCCTTTGATGAAGTAAGGGCTTTTTTCTTCGCAACACCATGAGTGCTCCTGTTACTACTTGTTCTGTATTTTGGGTAGCAGCCAGTGGCTCTATGCTTGGAAGGTCAATATATATATTATATATGTATGTATATTATATATGTGTGTATATATATGAATGTTGAATGTATTTTGGTTTTTTTTTCGAGCTTAAAAATCAGCTGAGTGCTTGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTCTGTACCACTTCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCCTCGGGTGCCTTAATATAAATACGGCCCTGATCTCACACATGGTTAATGTCCCTTATTAATACTTATAGGTCTTTTTCCTTTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTGCACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGTACATATTTTTACCAGATGAATCTTATATGTAATTAAATGTATTTTAGC
  3   1   2       bld Thy1      in                        CBST6483.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAATGTATTTTGGTTTTTTTTTCGAGGCTTAAAAATCAGCGGAGTGCTGGTGTTTGTTACCAGGGATAAAATACAGGGGCCACGTCTCTAAATCAGCTGCTTTGTACCACTTCACAATTGAAGGAGATTCAAGTCATGAACACAGCCTATGGAAATCCTTGGCGGAGGCTGCAGGCATATATTTTTTTAATTGAAACAAATATATAGGCACCTGAGAGCTGCCCCCCAAAACCTGCTGCCCTTAGCACAGGCCGTCGGGTGCCTTAATATAAATACGGCCCTGATGTCACACATGGTGAATGTCACTTATTAATACTTATAGGTCTTTTTCCTGTGTTGCTTGAGCAGGAAGATGTTCATAAAGCTTTTAAG
  5  -1   2       bld Int1                                CAAP12850.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGNAGCAGGAAGATGTTCATAAAGCTNTTAATGACAAAGCAACTCAACAATTCTGGGAATAAATCTCTTACTTTAATGGAGTTACTCTCTCTTACATTTTACCTGAAGATTTTATTGCAAGTATTGCACACACGGTATCACAGTGCCACTGTAGAATAAAGGGGATCTGTCCTTTGGTCGTTGTCTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)