Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM9708.3                            2 END     1          20       50                (no blast hit)

 This cluster: approximate FL confidence score = 59%

 1012088301 Xt7.1-CAAL9051.3 - 5 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL9051.3                             GCGACTCCTAACAGTGTGACTCCCACCAACTGCAGCTGGTGGCCCATTTCGGCTCATGAGAATGATGCCGGCAATTCCAAAGAGCTTGAAGATAACCCGGAGTCTTTCAGCCCCAAATCCAAGGACACTCTTGTTTTGTATCACTGGACACAGTCGTTTAGCTCTCAAAAGATACGACTGGTGATAGCCGAGAAGGGATTCCCGTGTGATGAGCGGGATGTCAGCTTGCCACTCACAGAGCACAAAGAGCCTTGGTTCATGCGCCTCAACCTCGGAGAAGAAGTGCCTGTGGTCATCCATGGGGACAACATTATTAGTGACTATAACCAAATCATTGATTACATTGAAAACAATTTTGTGGGAGAACTTATCCCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCATGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAAGAAAACTTGAATATGAAGGTCAGAAATGTGAACTTTGGCTTTGCGGCCACATCTTTACCTTAGCTGATGTTCTGCTGGGAGCCACACTACATCGGCTCAAGTTCCTAGGACTTTCCAAAAAATACTGGGAAGACGGAAGCCGACCGAACCTCCAGTTGTTCTTCGACAGAATACAGAAGCGATACGCATTCCGCAAAGTACTGGGAGACATCCACACGACCCTGCTGTCAGCCGTCTTGCCCAACGCCTTCCGACTAGTCAAACGGAAACCACCGTCTTTCTTCGGGGCCTCTTTCCTTATGGGGTCACTGGGAGGAATGGGATATTTTGCTTACTGGTACTTAAAGAAAAAATACATGTAACGACTTACCATT
                                                  Xt7.1-CHK-1008242215                                   CCTAACAGTGTGACTCCCACCAACTGCAGCTGGTGGCCCATTTCGGCTCATGAGAATGATGCCGGCAATTCCAAAGAGCTTGAAGATAACCCGGAGTCTTTCAGCCCCAAATCCAAGGACACTCTTGTTTTGTATCACTGGACACAGTCGTTTAGCTCTCAAAAGATACGACTGGTGATAGCCGAGAAGGGATTCCCGTGTGATGAGCGGGATGTCAGCTTGCCACTCACAGAGCACAAAGAGCCTTGGTTCATGCGCCTCAACCTCGGAGAAGAAGTGCCTGTGGTCATCCATGGGGACAACATTATTAGTGACTATAACCAAATCATTGATTACATTGAAAACAATTTTGTGGGAGAACTTATCCCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCATGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAAGAAAACTTGAATATGAAGGTCAGAAATGTGAACTTTGGCTTTGCGGCCACATCTTTACCTTAGCTGATGTTCTGCTGGGAGCCACACTACATCGGCTCAAGTTCCTAGGACTTTCCAAAAAATACTGGGAAGACGGAAGCCGACCGAACCTCCAGTTGTTCTTCGACAGAATACAGAAGCGATACGCATTCCGCAAAGTACTGGGAGACATCCACACGACCCTGCTGTCAGCCGTCTTGCCCAACGCCTTCCGACTAGTCAAACGGAAACCACCGTCTTTCTTCGGGGCCTCTTTCCTTATGGGGTCACTGGGAGGAATGGGATATTTTGCTTACTGGTACTTAAAGAAAAAATACATGTAACGACTT
                                                      consensus depths                                  3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     2     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      -3     103                             
                                               BLH MPR      -3     121                             
                                                                                                                                                                                                                        PROTEIN --- Br ==== 4e-007     AAQ83893.2 glutathione S-transferase [Branchiostoma belcheri tsingtaunese] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                  PROTEIN --- Dm ==== 7e-019     NP_647945.1 CG4623-PA [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 9e-020     XP_001199046.1 PREDICTED: similar to ganglioside-induced differentiation associated protein 1 [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 6e-125     XP_417379.2 PREDICTED: similar to Ganglioside-induced differentiation-associated protein 1-like 1 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PREDICTED = ?? ==== 2e-172     XP_708881.1 PREDICTED: similar to ganglioside-induced differentiation-associated protein 1-like 1 isoform 3 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PROTEIN === Mm ==== 3e-173     NP_659140.1 ganglioside-induced differentiation-associated protein 1-like 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PREDICTED = Dr ==== 3e-175     XP_687757.1 PREDICTED: similar to ganglioside-induced differentiation-associated protein 1-like 1 isoform 1 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PROTEIN === Hs ==== 6e-176     NP_076939.3 ganglioside-induced differentiation-associated protein 1-like 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                PROTEIN === Xt ==== 0          AAI18836.1 Ganglioside-induced differentiation-associated protein 1-like 1 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL9051.3                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------ATGTAA
                                                                   ORF                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2      seed Brn4 FL   in                         CAAL5473.5p CTCTTCTCTTGCATCCTCAGCTGTCATGGCGACTCCTAACAGTGTGACTCCCACCAACTGCAGCTGGTGGCCCATTTCGGCTCATGAGAATGATGCCGGCAATTCCAAAGAGCTTGAAGATAACCCGGAGTCTTTCAGCCCCAAATCCAAGGACACTCTTGTTTTGTATCACTGGACACAGTCGTTTAGCTCTCAAAAGATACGACTGGTGATAGCCGAGAAGGGATTCCCGTGTGATGAGCGGGATGTCAGCTTGCCACTCACAGAGCACAAAGAGCCTTGGTTCATGCGCCTCAACCTCGGAGAAGAAGTGCCTGTGGTCATCCATGGGGACAACATTATTAGTGACTATAACCAAATCATTGATTACATTGAAAACAATTTTGTGGGAGAACTTATCCCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCATGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAA
  3   1   2       bld Brn4      in                         CAAL9051.3p                             GCGACTCCTAACAGTGTGACTCCCACCAACTGCAGCTGGTGGCCCATTTCGGCTCATGAGAATGATGCCGGCAATTCCAAAGAGCTTGAAGATAACCCGGAGTCTTTCAGCCCCAAATCCAAGGACACTCTTGTTTTGTATCACTGGACACAGTCGTTTAGCTCTCAAAAGATACGACTGGTGATAGCCGAGAAGGGATTCCCGTGTGATGAGCGGGATGTCAGCTTGCCACTCACAGAGCACAAAGAGCCTTGGTTCATGCGCCTCAACCTCGGAGAAGAAGTGCCTGTGGTCATCCATGGGGACAACATTATTAGTGACTATAACCAAATCATTGATTACATTGAAAACAATTTTGTGGGAGAACTTATCCCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCATGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAAAGAAAACTTGAATATGAAGTC
  5   1   2       bld Brn4      in                         CAAL9051.5p                             GCGACTCCTAACAGTGTGACTCCCACCAACTGCAGCTGGTGGCCCATTTCGGCTCATGAGAATGATGCCGGCAATTCCAAAGAGCTTGAAGATAACCCGGAGTCTTTCAGCCCCAAATCCAAGGACACTCTTGTTTTGTATCACTGGACACAGTCGTTTAGCTCTCAAAAGATACGACTGGTGATAGCCGAGAAGGGATTCCCGTGTGATGAGCGGGATGTCAGCTTGCCACTCACAGAGCACAAAGAGCCTTGGTTCATGCGCCTCAACCTCGGAGAAGAAGTGCCTGTGGTCATCCATGGGGACAACATTATTAGTGACTATAACCAAATCATTGATTACATTGAAAACAATTTTGTGGGAGAACTTATCCCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCATGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAAAGAAAACTTGAATATGAAGTC
  5   1   2       bld Tad5      out                        XZT43425.5p                                                                                                                                                                                                                                                                                                                                                                  ACCAAATCATTGATTACATTGAAAACAATTTTGTGGGAGAACTTATCCCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCGTGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAAGAAAACTTGAATATGAAGGTCAGAAATGTGAACTTTGGCTTTGCGGCCACATCTTTACCTTAGCTGATGTTCTGCTGGGAGCCACACTACATCGGCTCAAGTTCCTAGGACTTTCCAAAAAATACTGGGAAGACGGAAGCCGACCGAACCTCCAGTTGTTCTTCGACAGAATACAGAAGCGATACGCATTCCGCAAAGTACTGGGAGACATCCACACGACCCTGCTGTCAGCCGTCTTGCCCAACGCCTTCCGACTAGTCAAACGGAAACCACCGTCTTTCTTCGGGGCCTCTTTCCTTATGGGGTCACTGGGAGGAATGNGATATTTTGCTTACTGGTACTTAAAGAAAAAATACATGTAACGACTTACCCATTGGTGTAGTTTGACGTCTCTGTGCTATAT
  3   1   2       bld Brn4 FL   in                         CAAL5473.3p                                                                                                                                                                                                                                                                                                                                                                                                                 CCTAAATTGATACCAGAAACTGAGACCATTTTCCACTCTAGAGTCCTCCAATACAGAGAAATCTTGGACAAGCTGCCAATGGATGCCTACACACACGGATGCATCCTCCACCCGGAGCTCACTACGGATTCCATGATCCCAAAGTACGCCACCGCTGAGATCCGCCGACATTTGGCCAACGCCAGCACAGAACTGACAAAACTTGATCACGAGGAGCCTCAACTTATGGAGCCATATCTCTCCAAACAGAAGAAGCTCATGGCTAAGATATTGGAACATGATAATGTGAACTACTTGACCAAGATTCTAATACAGCTATCAATGGTTCTAGACCAAATTGAAGCAGAGCTGGAAAAAAGAAAACTTGAATATGAAGGTCAGAAATGTGAACTTTGGCTTTGCGGCCACATCTTTACCTTAGCTGATGTTCTGCTGGGAGCCACACTACATCGGCTCAAGTTCCTAGGACTTTCCAAAAAATACTGGGAAGACGGAAGCCGACCGAACCTCCAGTTGTTCTTCGACAGAATACAGAAGCGATACGCATTCCGCAAAGTACTGGGAGACATCCACACGACCCTGCTGTCAGCCGTCTTGCCCAACGCCTTCCGACTAGTCAAACGGAAACCACCGTCTTTCTTCGGGGCCTCTTTCCTTATGGGGTCACTGGGAGGAATGGGATATTTTGCTTACTGGTACTTAAAGAAAAAATACATGTAACGACTTACCATTGGTGTTAGTTTGACGTCTCTGTGCTATATGTGGTATTATCGAGCCTAGTAACAGTATAAGAAATCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)