Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012088411 Xt7.1-CABE10754.5 - 9 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE10754.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACGAGACTTATGTGAAGCTGCTGGCCTTACGCATGCAAGGGGGATGTGAAGACATCAGCACCTGGGAGTCCATGCTTACAGAACCTGATGGGGTCAGCGAGGAGACCAATGGGGAATTAAAGAGGTCCCACTCAAGCCCCTCACTCAATGCTGAAAGCTCCCCAGTGGTTGTAAAGGTTAAACGCAACATATCAGAACGTCGGACTTACCGCAGGATAATCCCCAAGCGTAATAAGAACCTTGTGTGATCTAAGTACCTCCTGCAACATGGCAGCACCCCTCCTGCATATGGAAGGGCTCACACTTACAAAGGTGCCCTCTACTGAAGAAAACTGCACCATGGAAATTTGTATATGGCTGGAAAGATTTACAGAGATATGTGTAAAAGCCATGAACTAATGTAGGCAGTCTTCACCCACCCAAGCACTTAGCATGCAGCTCATCAACACACAGTAAGGCCCATGTGTTTGGATCCCATGGAACCCCTGGCAGACTTAATGCCATAGCTGAATGGGAGCCATATAGATCCTGTAGTAATGAGTCGCAAATCCTGGGCAACTGTTTCCTTGTTGAAAAGCTGCAGTGGGTTACTGTTAGTGTGGGGCAGTATTCTCTGCTTTTACCTCTAGATGGCGCCCTTGACTTATGTTAAAGACTTTGGTCTAGAAGAGGAAATTCTATAGCATAGTGTTCACCTAATGTTTTTAAAAAATGTTAATGAGCAAAAAAAAAGATTTAAATTATTTATTTTATTTGATGTTACTCAGTTCTCAGGCAGGCCTCAGGCCACATAACGATAATTGTGACTGCTAGTCGCGACCCTGCAGGAGGGGGTCCAGTGGACTGCACAGTACTCTCCCCAGGTAAATGTACAACTGTAACTGGAAATCAGTACTGTAAGTGCAGAAATAGAAGGATCTGGATTGAACTGTTATCCTGCAACTTGCCTGATTTCCCCATTGCAATGTAGAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCTGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATTGCCTTGTGTAATGACTGAAATAGAGTAGGACTTTATGTACTTACCTTGAAAATTTGTGGCCAAGACAGCATGGAAGTCCTTTCTATTCCCCAAAGGCATGGATTGTCAGTGAGTGGATGCACATCCCGGTTACAGAAATCTCTGTATGTTAAACTGTCAGCTTAAACTTCATTCAGCCACTCCCCGTGCATTTTGCAGTGTATTTGGTACGTTAGGGGACTGTAGTGCAAGAGAAGCTACTTGATGTATTTGTGCCTTGCTGCTCTGTTTATGTTTACATACCAACTACTGCCTTTGGTCTTTCATTTGCTCAGGATGTGCCAGCCGTACTTGATAAAGAGCGCCATGCTATATAATATGCTATATAAGTGACACACTATCTAATCGGCTCAGTGTTTCATCCTTTAGTGTCTGTGCAGCTGCCTTTGTATCAGCAGGATGAGACTTTCGCTTTCCTAAAGCTGGCCATACACATTGGTGAAGTCGTCAAACAAGCAGATCTTTCGATATGCCCACCTATGGTGGGTGACATTGTGCCAACACAATACATTACAATGACCGAAATAGGAGCTGTCGGAGCAAGGATGAGCCAATGTCCTCAATCTCATGGAAAATATCCGCCCTACGCCTCGTCTGGCATTAGCCTTAACAGGCTCTAATCTGTCTGTGTATGATCACCTTTAGGAAAATTGGAGCCTTTGAGATCAGATAAATGTGTTTCTTTATGGCTGTCTGAGACCAGTAAGGAGCCATCTCACAGGCATGTAATAGGAGGAATAGTATTTGTTCCATATGGGATGACGGTACTGTGGCACTCTCAGAGAATGTACATATCATTTCAGTGTCAGTCTGCGCAGTAACATTTTAACGTTTTCTGGTTGCATGCCTGTTTGCAGTTTTACATTTGTTTAAGTTATGAAACATTGGGTGAGAAATGGCCGAAAATCTCACTCTGGCTGGCCTTCAGGCTCAGGGTTCCATCCGCTACTGGAAGTGGTGGGGATCCCCTAGAATTTGGTAATGTCTCATCTAGAGCTGCACCGTAGAGTCTTCTCCGAAGCTGCCCTCACCCTGCCTCTCAGGTACTCAGTTTAGATTATACAACCTGCAGGGCCTCCTGCTTTTTTGCACTGGAAACCAAACTGAAATAA
                                                  Xt7.1-CHK-1008237294                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTTATGTGAAGCTGCTGGCCTTACGCATGCAAGGGGGATGTGAAGACATCAGCACCTGGGAGTCCATGCTTACAGAACCTGATGGGGTCAGCGAGGAGACCAATGGGGAATTAAAGAGGTCCCACTCAAGCCCCTCACTCAATGCTGAAAGCTCCCCAGTGGTTGTAAAGGTTAAACGCAACATATCAGAACGTCGGACTTACCGCAGGATAATCCCCAAGCGTAATAAGAACCTTGTGTGATCTAAGTACCTCCTGCAACATGGCAGCACCCCTCCTGCATATGGAAGGGCTCACACTTACAAAGGTGCCCTCTACTGAAGAAAACTGCACCATGGAAATTTGTATATGGCTGGAAAGATTTACAGAGATATGTGTAAAAGCCATGAACTAATGTAGGCAGTCTTCACCCACCCAAGCACTTAGCATGCAGCTCATCAACACACAGTAAGGCCCATGTGTTTGGATCCCATGGAACCCCTGGCAGACTTAATGCCATAGCTGAATGGGAGCCATATAGATCCTGTAGTAATGAGTCGCAAATCCTGGGCAACTGTTTCCTTGTTGAAAAGCTGCAGTGGGTTACTGTTAGTGTGGGGCAGTATTCTCTGCTTTTACCTCTAGATGGCGCCCTTGACTTATGTTAAAGACTTTGGTCTAGAAGAGGAAATTCTATAGCATAGTGTTCACCTAATGTTTTTAAAAAATGTTAATGAGCAAAAAAAAAGATTTAAATTATTTATTTTATTTGATGTTACTCAGTTCTCAGGCAGGCCTCAGGCCACATAACGATAATTGTGACTGCTAGTCGCGACCCTGCAGGAGGGGGTCCAGTGGACTGCACAGTACTCTCCCCAGGTAAATGTACAACTGTAACTGGAAATCAGTACTGTAAGTGCAGAAATAGAAGGATCTGGATTGAACTGTTATCCTGCAACTTGCCTGATTTCCCCATTGCAATGTAGAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCTGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATTGCCTTGTGTAATGACTGAAATAGAGTAGGACTTTATGTACTTACCTTGAAAATTTGTGGCCAAGACAGCATGGAAGTCCTTTCTATTCCCCAAAGGCATGGATTGTCAGTGAGTGGATGCACATCCCGGTTACAGAAATCTCTGTATGTTAAACTGTCAGCTTAAACTTCATTCAGCCACTCCCCGTGCATTTTGCAGTGTATTTGGTACGTTAGGGGACTGTAGTGCAAGAGAAGCTACTTGATGTATTTGTGCCTTGCTGCTCTGTTTATGTTTACATACCAACTACTGCCTTTGGTCTTTCATTTGCTCAGGATGTGCCAGCCGTACTTGATAAAGAGCGCCATGCTATATAATATGCTATATAAGTGACACACTATCTAATCGGCTCAGTGTTTCATCCTTTAGTGTCTGTGCAGCTGCCTTTGTATCAGCAGGATGAGACTTTCGCTTTCCTAAAGCTGGCCATACACATTGGTGAAGTCGTCAAACAAGCAGATCTTTCGATATGCCCACCTATGGTGGGTGACATTGTGCCAACACAATACATTACAATGACCGAAATAGGAGCTGTCGGAGCAAGGATGAGCCAATGTCCTCAATCTCATGGAAAATATCCGCCCTACGCCTCGTCTGGCATTAGCCTTAACAGGCTCTAATCTGTCTGTGTATGATCACCTTTAGGAAAATTGGAGCCTTTGAGATCAGATAAATGTGTTTCTTTATGGCTGTCTGAGACCAGTAAGGAGCCATCTCACAGGCATGTAATAGGAGGAATAGTATTTGTTCCATATGGGATGACGGTACTGTGGCACTCTCAGAGAATGTACATATCATTTCAGTGTCAGTCTGCGCAGTAACATTTTAACGTTTTCTGGTTGCATGCCTGTTTGCAGTTTTACATTTGTTTAAGTTATGAAACATTGGGTGAGAAATGGCCGAAAATCTCACTCTGGCTGGCCTTCAGGCTCAGGGTTCCATCCGCTACTGGAAGTGGTGGGGATCCCCTAGAATTTGGTAATGTCTCATCTAGAGCTGCACCGTAGAGTCTTCTCCGAAGCTGCCCTCACCCTGCCTCTCAGGTACTCAGTTTAGATTATACAACCTGCAGGGCCTCCTGCTTTTTTGCACTGGAAACCAAACTGAAATAAAAGGCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     2     4     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 5e-007     XP_707172.1 PREDICTED: similar to Pleckstrin and Sec7 domain containing protein 3 (Exchange factor for ADP-ribosylation factor guanine nucleotide factor 6) (Hepatocellular carcinoma-associated antigen 67) isoform 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-017     NP_036587.2 pleckstrin and Sec7 domain containing 4 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-018     NP_808279.1 pleckstrin and Sec7 domain containing 4 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE10754.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------TGA---------------------------ATG---------------------ATG------------------ATGTAG------------------------TAG------------------------------ATG------------ATG------------------ATG---TAG------------------------------ATG---------------------------------------------------------------------------------------TAGATG------------------------------------------------TAG---------------ATG------------------------------------------------------------------------------------------TAA---TAA---TGA------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TAG---------------------------------------ATG---------TAG---ATG------------TAA------------------------TGA---------------------------------------------------ATG------------------------------------------------------------------------------------------TAA---------------------------------------------------------TAG------------------ATG------------------------ATG------------------------------------------ATG---------------------------ATG---------ATG---------TGA---------TAA---------------------TAG------------------------------ATG---------------TAA------------------------------------------------------------------------------------------------TGA------TAG------------------TGA------------------ATG------------------------------------------------------------------------TAG---------------TGA------------------------------------------------------------ATGTAATAG------TAG------------ATG---TGA---------------------------------------------------------------------------------ATG------------------------TAA---ATG------------------------------------------------------------------------------------------TAG---------ATG---------------------------------------------------------------------TAG------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                              ]
  5   1   2      skin Spl2      in                        CBSS6953.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGAATTCGCTCGCACCCACGCGCTCCGAAAGAGGATTATCTCCGCTATGAGAAAACCAGGTACGAGACTTATGTGAAGCTGCTGGCCTTACGCATGCAAGGGGGATGTGAAGACATCAGCACCTGGGAGTCCATGCTTACAGAACCTGATGGGGTCAGCGAGGAGACCAATGGGGAATTAAAGAGGTCCCACTCAAGCCCCTCACTCAATGCTGAAAGCTCCCCAGTGGTTGTAAAGGTTAAACGCAACATATCAGAACGTCGGACTTACCGCAGGATAATCCCCAAGCGTAATAAGAACCTTGTGTGATCTAAGTACCTCCTGCAACATGGCAGCACCCCTCCTGCATATGGAAGGGCTCACACTTACAAAGGTGCCCTCTACTGAAGAAAACTGCACCATGGAAATTTGTATATGGCTGGAAAGATTTACAGAGATATGTGTAAAAGCCATGAACTAATGTAGGCAGTCTTCACCCACCCAAGCACTTAGCATGCAGCTCATCAACACACAGTAAGGCCCATGTGTTTGGATCCCATGGAACCCCTGGCAGACTTAATGCCATAGCTGAATGGGAGCCATATAGATCCTGTAGTAATGAGTCGCAAATCCTGGGCAACTGTTTCCTTGTTGAAAAGCTGCAGTGGGTTACTGTTAGTGTGGGGCAGTATTCTCTGCTTTTACCTCTAGATGGCGCCCTTGACTTATGTTAAAGACTTTGGTCTAGAAGAGGAAATTCTATAGCATAGTGTTCACCTAATGTTTTTAAAAAA
  3   1   2       bld Spl2      in                        CBSS6953.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACGAGACTTATGTGAAGCTGCTGGCCTTACGCATGCAAGGGGGATGTGAAGACATCAGCACCTGGGAGTCCATGCTTACAGAACCTGATGGGGTCAGCGAGGAGACCAATGGGGAATTAAAGAGGTCCCACTCAAGCCCCTCACTCAATGCTGAAAGCTCCCCAGTGGTTGTAAAGGTTAAACGCAACATATCAGAACGTCGGACTTACCGCAGGATAATCCCCAAGCGTAATAAGAACCTTGTGTGATCTAAGTACCTCCTGCAACATGGCAGCACCCCTCCTGCATATGGAAGGGCTCACACTTACAAAGGTGCCCTCTACTGAAGAAAACTGCACCATGGAAATTTGTATATGGCTGGAAAGATTTACAGAGATATGTGTAAAAGCCATGAACTAATGTAGGCAGTCTTCACCCACCCAAGCACTTAGCATGCAGCTCATCAACACACAGTAAGGCCCATGTGTTTGGATCCCATGGAACCCCTGGCAGACTTAATGCCATAGCTGAATGGGAGCCATATAGATCCTGTAGTAATGAGTCGCAAATCCTGGGCAACTGTTTCCTTGTTGAAAAGCTGCAGTGGGTTACTGTTAGTGTGGGGCAGTATTCTCTGCTTTTACCTCTAGATGGCGCCCTTGACTTATGTTAAAGACTTTGGTCTAGAAGAGGAAATTCTATAGCATAGTGTTCACCTAATGTTTTTAAAAAAGTGTTAATGAGC
  3   1   2      seed Ova1      in                        CABE10754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATTTACAGAGATATGTGTAAAAGCCATGAACTAATGTAGGCAGTCTTCACCCACCCAAGCACTTAGCATGCAGCTCATCAACACACAGTAAGGCCCATGTGTTTGGATCCCATGGAACCCCTGGCAGACTTAATGCCATAGCTGAATGGGAGCCATATAGATCCTGTAGTAATGAGTCGCAAATCCTGGGCAACTGTTTCCTTGTTGAAAAGCTGCAGTGGGTTACTGTTAGTGTGGGGCAGTATTCTCTGCTTTTACCTCTAGATGGCGCCCTTGACTTATGTTAAAGACTTTGGTCTAGAAGAGGAAATTCTATAGCATAGTGTTCACCTAATGTTTTTAAAAAATGTTAATGAGCAAAAAAAAAGATTTAAATTATTTATTTTATTTGATGTTACTCAGTTCTCAGGCAGGCCTCAGGCCACATAACGATAATTGTGACTGCTAGTCGCGACCCTGCAGGAGGGGGTCCAGTGGACTGCACAGTACTCTCCCCAGGTAAATGTACAACTGTAACTGGAAATCAGTACTGTAAGTGCAGAAATAGAAGGATCTGGATTGAACTGTTATCCTGCAACTTGCCTGATTTCCCCATTGCAATGTAGAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCTGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATT
  5   1   2       bld Ova1      in                        CABE10754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGATTTACAGAGATATGTGTAAAAGCCATGAACTAATGTAGGCAGTCTTCACCCACCCAAGCACTTAGCATGCAGCTCATCAACACACAGTAAGGCCCATGTGTTTGGATCCCATGGAACCCCTGGCAGACTTAATGCCATAGCTGAATGGGAGCCATATAGATCCTGTAGTAATGAGTCGCAAATCCTGGGCAACTGTTTCCTTGTTGAAAAGCTGCAGTGGGTTACTGTTAGTGTGGGGCAGTATTCTCTGCTTTTACCTCTAGATGGCGCCCTTGACTTATGTTAAAGACTTTGGTCTAGAAGAGGAAATTCTATAGCATAGTGTTCACCTAATGTTTTTAAAAAATGTTAATGAGCAAAAAAAAAGATTTAAATTATTTATTTTATTTGATGTTACTCAGTTCTCAGGCAGGCCTCAGGCCACATAACGATAATTGTGACTGCTAGTCGCGACCCTGCAGGAGGGGGTCCAGTGGACTGCACAGTACTCTCCCCAGGTAAATGTACAACTGTAACTGGAAATCAGTACTGTAAGTGCAGAAATAGAAGGATCTGGATTGAACTGTTATCCTGCAACTTGCCTGATTTCCCCATTGCAATGTAGAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCTGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       out                        CAAN9265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGCATAGTGTTCACCTAATGTTTTTAAAAAATGTTTATGAGCAAAAAAAAAGATTTTAAATTATTTATTTTATTTGATGTTACTCAGTTCTCAGGCAGGCCTCAGGCCACATAACGATAATTGTGACTGCTAGTCGCGACCCTGCAGGAGGGGGTCCAGTGGACTGCACAGTACTCTCCCCAGGTAAATGTACAACTGTAACTGGAAATCAGTACTGTAAGTGCAGAAATAGAAGGATCTGGATTGAACTGTTATCCTGCAACTTGCCTGATTTCCCCATTGCAATGTAGAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCTGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATTGCCTTGTGTAATGACTGAAATAGAGTAGGACTTTATGTACTTACCTTGAAAATTTGTGGCCAAGACAGCATGGAAGTCCTTTCTATTCCCCAAAGGCATGGATTGTCAGTGAGTGGATGCACATCCCGGTTACAGAAATCTCTGTATGTTAAACTGTCAGCTTAAACTTCATTCAGCCACTCCCCGTGCATTTTGCAGTGTATTTGGTACGTTAGGGGACTGTAGTGCAAGAGAAGCTACTTGATGTATTTGTGCCTTGCTGCTCTGTTTATGTTTACATACCAACTACTGCCTTTGGTCTTTCATTTGCTCAGGATGTGCCAGCCGTACTTGATAAAGAGCGCCATGCTATATAATATGCTAT
  5   1   2       bld Thy1      in                        CBST1245.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTTCTCAGGCAGGCCTCAGGCCACATAACGATAATTGTGACTGCTAGTCGCGACCCTGCAGGAGGGGGTCCAGTGGACTGCACAGTACTCTCCCCAGGTAAATGTACAACTGTAACTGGAAATCAGTACTGTAAGTGCAGAAATAGAAGGATCTGGATTGAACTGTTATCCTGCAACTTGCCTGATTTCCCCATTGCAATGTAGAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCTGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATTGCCTTGTGTAATGACTGAAATAGAGTAGGACTTTATGTACTTACCTTGAAAATTTGTGGCCAAGACAGCATGGAAGTCCTTTCTATTCCCCAAAGGCATGGATTGTCAGTGAGTGGATGCACATCCCGGTTACAGAAATCTCTGTATGTTAAACTGTCAGCTTAAACTTCATTCAGCCACTCCCCGTGCATTTTGCAGTGTATTTGGTACGTTAGGGGACTGTAGTGCAAGAGAAGCTACTTGATGTATTTGTGCCTTGCTGCTCTGTTTATGTTTACATACCAACTACTGCCTTTGGTCTTTCATTTGCTCAGGATGTGCCAGCCGTACTTGATAAAGAGCGCCATGCTATATAATATGCTATATAAGTGACACACTATCTAATCGGCTCAGTG
  5   1   2       bld Spl2      in                        CBSS7147.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACTGCATGATCCTTATGTGAATTTGCATCCAGCAAAAACCCCGCATCTTTATTAGGGGACATTTTCGGGTAGAGAAGAGAGGGCAGTTGTCTTGGGTCAACTGCCTGTGATATGGCTCTTGATTAGAAAATGTACTTGATAAAATAAGATATTATTGCCTTGTGTAATGACTGAAATAGAGTAGGACTTTATGTACTTACCTTGAAAATTTGTGGCCAAGACAGCATGGAAGTCCTTTCTATTCCCCAAAGGCATGGATTGTCAGTGAGTGGATGCACATCCCGGTTACAGAAATCTCTGTATGTTAAACTGTCAGCTTAAACTTCATTCAGCCACTCCCCGTGCATTTTGCAGTGTATTTGGTACGTTAGGGGACTGTAGTGCAAGAGAAGCTACTTGATGTATTTGTGCCTTGCTGCTCTGTTTATGTTTACATACCAACTACTGCCTTTGGTCTTTCATTTGCTCAGGATGTGCCAGCCGTACTTGATAAAGAGCGCCATGCTATATAATATGCTATATAAGTGACACACTATCTAATCGGCTCAGTGTTTCATCCTTTAGTGTCTGTGCAGCTGCCTTTGTATCAGCAGGATGAGACTTTCGCTTTCCTAAAGCTGGCCATACACATTGGTGAAGTCGTCAAACAAGCAGATCTTTCGATATGCCCACCTATGGTGGGTGACATTGTGCCAACACAATACATTACAA
  3   1   2      skin Thy1      in                        CBST1245.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAGGATGAGACTTTCGCTTTCCTAAAGCTGGCCATACACATTGGTGAAGTCGTCAAACAAGCAGATCTTTCGATATGCCCACCTATGGTGGGTGACATTGTGCCAACACAATACATTACAATGACCGAAATAGGAGCTGTCGGAGCAAGGATGAGCCAATGTCCTCAATCTCATGGAAAATATCCGCCCTACGCCTCGTCTGGCATTAGCCTTAACAGGCTCTAATCTGTCTGTGTATGATCACCTTTAGGAAAATTGGAGCCTTTGAGATCAGATAAATGTGTTTCTTTATGGCTGTCTGAGACCAGTAAGGAGCCATCTCACAGGCATGTAATAGGAGGAATAGTATTTGTTCCATATGGGATGACGGTACTGTGGCACTCTCAGAGAATGTACATATCATTTCAGTGTCAGTCTGCGCAGTAACATTTTAACGTTTTCTGGTTGCATGCCTGTTTGCAGTTTTACATTTGTTTAAGTTATGAAACATTGGGTGAGAAATGGCCGAAAATCTCACTCTGGCTGGCCTTCAGGCTCAGGGTTCCATCCGCTACTGGAAGTGGTGGGGATCCCCTAGAATTTGGTAATGTCTCATCTAGAGCTGCACCGTAGAGTCTTCTCCGAAGCTGCCCTCACCCTGCCTCTCAGGTACTCAGTTTAGATTATACAACCTGCAGGGCCTCCTGCTTTTTTGCACTGGAAACCAAACTGAAATAAAAGCGGGTATATCTAAAG
  3   1   0       add Spl2      in                        CBSS7147.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGTGTAGCGGAGATGTGCATAAGAATGCAAGAGTTTGAAAGTCTGACGTTTTTATGCTAGTTTCGGCTGCGTGTGCCTGCGCCCGAGCGTGTTCCGGTCGTTCGGGTGCAGGCACGTGTGGGAGGCTGGGGTGGTGTTTTCGGCGAGCACTTTTCCGCTTGCCGAGAATATCCGCCCTGCGCCTCGTCTGGCATTGGCCTTAACAGGCTCTAATCTGTCTGTGTATGATCACCTTTAGGAAAATTGGAGCCTTTGAGATCAGATAAATGTGTTTCTTTATGGCTGTCTGAGACCAGTAAGGAGCCATCTCACAGGCATGTAATAGGAGGAATAGTATTTGTTCCATATGGGATGACGGTACTGTGGCACTCTCAGAGAATGTACATATCATTTCAGTGTCAGTCTGCGCAGTAACATTTTAACGTTTTCTGGTTGCATGCCTGTTTGCAGTTTTACATTTGTTTAAGTTATGAAACATTGGGTGAGAAATGGCCGAAAATCTCACTCTGGCTGGCCTTCAGGCTCAGGGTTCCATCCGCTACTGGAAGTGGTGGGGATCCCCTAGAATTTGGTAATGTCTCATCTAGAGCTGCACCGTAGAGTCTTCTCCGAAGCTGCCCTCACCCTGCCTCTCAGGTACTCAGTTTAGATTATACAACCTGCAGGGCCTCCTGCTTTTTTGCACTGGAAACCAAACTGAAATAAAAGGCGGTATATCTAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)