Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA024a15.3                         12 END     5         100       41                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012088427 Xt7.1-CAAK3372.5 - 5 ESTs
                                                                       .....-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK3372.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTACAAGTAGCTTCAATACATGAAGGGTGATTATTTCTCAAGTCCTTAAACTCTTCCATTAATAACATTAACAGGAAACTATGGCTGCTGCCTCTGTTTTAAACGTGGATGCCCTGCGAGAGGTGCTTGAATGCCCCATATGTATGGAAGCATACACTGAAGAACTGCTGAGACCCAAGCTCTTGCAGTGCGGTCATACCACATGCACACAGTGTCTGGAAAAGCTGTTGGCCAGTAACATAAATGGAGTGCGTTGCCCCTTTTGTAGTCGGGTAACACGTGTCACCAGCTTAGCCAACTTGGCTGATAACTTGACTGTTCTAAAGATCATTAACACTAGTGAGTTGGGCCAGACTGTTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGAAGACTCTCTAGAAGAAGAAGCTGAGCCTGAACTTGCAGCTGACTTGACATCAGAGCTTACCTTGCAGGATCCTGAGTTCCTCAAAGTAGGGCATGCTGGACCAATACAGGTTGGCCAAGTTGTCAAGAAGCCATACATTGTAAATATGCAGGAACCTCTTCCTGAAGTTTCTACATTTACTACAATTTCATATAAAGAGATGGATATGCAGTCAGAGGAGATTAGCAGTGTCCAGTCTTGTCCATCTGCTCCA
                                                  Xt7.1-CHK-1008242950                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTAGCTTCAATACATGAAGGGTGATTATTTCTCAAGTCCTTAAACTCTTCCATTAATAACATTAACAGGAAACTATGGCTGCTGCCTCTGTTTTAAACGTGGATGCCCTGCGAGAGGTGCTTGAATGCCCCATATGTATGGAAGCATACACTGAAGAACTGCTGAGACCCAAGCTCTTGCAGTGCGGTCATACCACATGCACACAGTGTCTGGAAAAGCTGTTGGCCAGTAACATAAATGGAGTGCGTTGCCCCTTTTGTAGTCGGGTAACACGTGTCACCAGCTTAGCCAACTTGGCTGATAACTTGACTGTTCTAAAGATCATTAACACTAGTGAGTTGGGCCAGACTGTTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGAAGACTCTCTAGAAGAAGAAGCTGAGCCTGAACTTGCAGCTGACTTGACATCAGAGCTTACCTTGCAGGATCCTGAGTTCCTCAAAGTAGGGCATGCTGGACCAATACAGGTTGGCCAAGTTGTCAAGAAGCCATACATTGTAAATATGCAGGAACCTCTTCCTGAAGTTTCTACATTTACTACAATTTCATATAAAGAGATGGATATGCAGTCAGAGGAGATTAGCAGTGTCCAGTCTTGTCCATCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG      81     519                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN      78      78                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR      81     189                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               ORF LNG      81      15                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Dm ==== 4e-008     NP_611390.2 CG15105-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ci ---- 5e-011     FAA00076.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Dr ---= 9e-013     XP_708552.1 PREDICTED: similar to tripartite motif-containing 2 isoform 3 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 9e-013     AAH70974.1 MGC78802 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 1e-013     XP_001232573.1 PREDICTED: similar to Tripartite motif-containing 13 isoform 1 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN -== Ce ==== 7e-014     NP_494241.2 zn-finger, RING and Zn-finger, B-box family member (37.9 kD) (2C613) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 6e-016     XP_796849.2 PREDICTED: similar to neural activity-related ring finger protein, partial [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 2e-093     XP_691234.1 PREDICTED: similar to Tripartite motif protein 32 (Zinc-finger protein HT2A) (72 kDa Tat-interacting protein) [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ==== 5e-113     NP_444314.1 tripartite motif protein 32 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN -== Hs ==== 8e-114     NP_036342.1 TAT-interactive protein, 72-KD; tripartite motif protein TRIM32; zinc-fingerprotein HT2A [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          AAI35999.1 Unknown (protein for MGC:122530) [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK3372.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGA------------------------------------TAATAA---TAA---------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ...
  0   1   1           Brn3 FL                          CAAK3372.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGGATTGCCTGCCGCAGATCATGCGTGACATCTTACAAGTAGCTTCAATACATGAAGGGTGATTATTTCTCAAGTCCTTAAACTCTTCCATTAATAACATTAACAGGAAACTATGGCTGCTGCCTCTGTTTTAAACGTGGATGCCCTGCGAGAGGTGCTTGAATGCCCCATATGTATGGAAGCATACACTGAAGAACTGCTGAGACCCAAGCTCTTGCAGTGCGGTCATACCACATGCACACAGTGTCTGGAAAAGCTGTTGGCCAGTAACATAAATGGAGTGCGTTGCCCCTTTTGTAGTCGGGTAACACGTGTCACCAGCTTAGCCAACTTGGCTGATAACTTGACTGTTCTAAAGATCATTAACACTAGTGAGTTGGGCCAGACTGTTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGAAGACTCTCTAGAAGAAGAAGCTGAGCCTGAACTTGCAGCTGACTTGACATCAGAGCTTACCTTGCAGGATCCTGAGTTCCTCAAAGTAGGGCATGCTGGACCAATACAGGTTGGCCAAGTTGTCAAGAAGCCATACATTGTAAATATGCAGGAACCTCTTCCTGAAGTTTCTACATTTACTACAATTTCATATAAAGAGATGGATATGCAGTCAGAGGAGATTAGCAGTGTCCAGTCTTGTCCATCTGCTCCACTTACCAAAATTCCTGAAGCATCATGCAACTTGCAGCAGTGTCAATTCCTAAGGAAGATGGGCTCTAAAGGAAACATGCCTGGCATGTTTAACCTTCCAGTGAGTCTTCATGTTACTGCACTAGGGGAAGTGTTGGTGGCTGACAGAGGCAACTGCAGAATCCAGGTCTTTAACCGAAAAGGTTTCTTGAGAGAGATTAGGCGAAGCCCATCTGGAATTGACACTTTTGTGCTGAGCTTTCTTGGGGCAGATTTGCCCAATCTCATTCCATTATCGGTAACAATGAACTGTCATGGCCTTATAGGAGTGACAGACAATTATGATAATTCAGTGAAAGTGTATACAATGGAGGGACATTGTATAGCATGCCACAGAAGTCAGCTCAGCAAGCCTTGGGGCATTGCAGCTATGCCCTCGGGTCAGTTTGTGGTAACTGATGTTGAAGGAGGGAAGCTCTGGTGCCTAACCGTAGATCGCAGCTTGGGAGTCGTCAAGTACAGTCGGCTCTGCAATGCTGTGCGTCCAAAGTTTGTCACTTGTGACCAGGAAGGGACTGTATATTTTACCCAAGGACTTGGCCTTAACCTAGAAAACCGTCAATTTGAGCATCATCTAGAGGGTGGCTTCTCTATTGGCTCTGTAGGGTCTGATGGACAGCTAGGGAGACAGATAAGCCACTTCTTTTCCGAAAATGAAGATTTTCGCTGCATTGCAGGGATGTGTGTTGGAGCTCGTGGAGATTTGATAGTGGCAGACAGTGGTCGTAAAGAAATACTTCATTTTCCTAAAAGTGGAGGCTACAGTATCTTAATTAGGGAGGGCCTGACTTGCCCAGTAGGAGTTTCTGTTACTCCTAAAGGACAGTTGTTGGTGCTGGATTGTTGGGATCACTGTATTAAAATATATAGTTATAATGTACGCAGGTACTCTACCCCTTAGGTGAAACCCTGTTTACAATTCCTAGATACCACTCAGGATTCTAGAACAGACAGTCCCTGTGGACGTCAGAAACCATAAAGTAGTAGTAAAACTGTTTAAGTGCTAGCTTGCACACCAGTACATTTATAGCACTTAAATAAGATACATATGTATGTAACTCACATCATTTCTGGCCTAACTGCCCTTATGTCATGTAACCTTCTTAAATGTGAATGTTCTTAAAAATGAAGTCTCAGTCAAGAATAATATAGAGTAGTTTTGTCAACTGTGAGTTAATGTATCTCAGGACTATCTGACTATCAGACAGTTAAAAAATAAATTAGAGAGGGTAATTTACTTATGCATGGTTAGTAATACATGGCAAAGTATATTAATAGTTAAAACACAACTAGACTAGACCCTTTAATTGTAAACTGACTGCTCAGTTATAATAAAACGAAGAAAACAAAGCATGATATGCTCAGCATTACAGGAGAGAAATCTCTTTCTGATTCTAACAAACACTCGCTGGTTTCTTAATAGACACATCAATTGAAATGAAGCTTCCACCATCTGTTCTGCCCAGGAATTACAGAAGGGACATGATTTGCAGTCATGTCATGAGAAGTGAGATGGAAAAGCTTTAAGTCTCTGGTCCTGTCATTTATTTCTTACTACTTGTTCCTGTCTTATTACAGACACAGAGATAGAAAATAAAGCTGGTGCGATTAACCCTGCTCACCTATTTGTACACTGCCCTTAAGATTAAGGATAAAATATCTCGCCAACTTTATTCCAGTCATACTCAGAGTAAAATCAGTCAGTTAAAATGATCTGTGTATACAAAACTGTAATTACTTGATTTTATGGGTGGAGTATTAAATCAGTGTGTTATATTATTCATTTAGACCTTTTAGTAATTGAATATATCCCTAATTTTCCACATTATCTAAGATACATTTCTTTCTGATGTGCAGCTGCTAGTACTGAACATGTATTAAATAAAGCAATTACCAGATATAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FL   out                        CAAK3372.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCGGATTGCCTGCCGCAGATCATGCGTGACATCTTACAAGTAGCTTCAATACATGAAGGGTGATTATTTCTCAAGTCCTTAAACTCTTCCATTAATAACATTAACAGGAAACTATGGCTGCTGCCTCTGTTTTAAACGTGGATGCCCTGCGAGAGGTGCTTGAATGCCCCATATGTATGGAAGCATACACTGAAGAACTGCTGAGACCCAAGCTCTTGCAGTGCGGTCATACCACATGCACACAGTGTCTGGAAAAGCTGTTGGCCAGTAACATAAATGGAGTGCGTTGCCCCTTTTGTAGTCGGGTAACACGTGTCACCAGCTTAGCCAACTTGGCTGATAACTTGACTGTTCTAAAGATCATTAACACTAGTGAGTTGGGCCAGACTGTTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGAAGACTCTCT
  5   1   2      seed Ovi1 5g3  out                       CABI12439.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTACAAGTAGCTTCAATACATGAAGGGTGATTATTTCTCAAGTCCTTAAACTCTTCCATTAATAACATTAACAGGAAACTATGGCTGCTGCCTCTGTTTTAAACGTGGATGCCCTGCGAGAGGTGCTTGAATGCCCCATATGTATGGAAGCATACACTGAAGAACTGCTGAGACCCAAGCTCTTGCAGTGCGGTCATACCACATGCACACAGTGTCTGGAAAAGCTGTTGGCCAGTAACATAAATGGAGTGCGTTGCCCCTTTTGTAGTCGGGTAACACGTGTCACCAGCTTAGCCAACTTGGCTGATAACTTGACTGTTCTAAAGATCATTAACACTAGTGAGTTGGGCCAGACTGTTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTT
  5   1   2   10  bld Ski1 5g3  out                        CABJ2185.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGATTCAATCGGCACGAGGGGAAACTATGGCTGCTGCCTCTGTTTTAAACGTGGATGCCCTGCGAGAGGTGCTTGAATGCCCCATATGTATGGAAGCATACACTGAAGAACTGCTGAGACCCAAGCTCTTGCAGTGCGGTCATACCACATGCACACAGTGTCTGGAAAAGCTGTTGGCCAGTAACATAAATGGAGTGCGTTGCCCCTTTTGTAGTCGGGTAACACGTGTCACCAGCTTAGCCAACTTGGCTGATAACTTGACTGTTCTAAAGATCATTAACACTAGTGAGTTGGGCCAGACTGTTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGGAGACTCTCTAG
  5   1   2       bld Brn4      out                       CAAL23152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGACTGTCTATAGGATTGATGTGCAAATCCTGCAAGCGAAGATTACCACGGTTCTTCTGTAAGAACTGCATTGTTTCATTATGTGATGCCTGCAAAGAAGCAGATCACGTGCTACTAAACCATATTGTACTTTCACTACAAGATGCTGCCAATGAACGCAGAAAAACACTAGAAGAAAGGCTTGCTAAACTCAGACAGTGCATGCAGGATCTGCAGAAAAGGAAGTCCATATTGGAGGGTCTCACTTCTCAGGTTAAGTGCAAATACAAGTCAATTTTACAAGATTACAGCAAAGAGGAATGTCGAGTTCAGGAAGAGTTAGCTCGCTCACGAAAAATGTTCACGGCATCTTTGTCAGAAGTTGAAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGAAGACTCTCTAGAAGAAGAAGCTGAGCCTGAACTTGCAGCTGACTTGACATCAGAGCTTACCTTGCAGGATCCTGAGTTCCTCAAAGTAGGGCATGCTGGACCAATACAGGTTGGCCAAGTTGTCAAGAAGCCATACATTGTAAATATGCAGGAACCTCTTCCTGAAGTTTCTACATTTACTACAATTTCATATAAAGAGATGGATATGCAGTCAGAGGAGATTAGCAGTGTCCAGTCTTGTCCATCTGCTCCACTTAC
  3  -1   2       bld Int1      out                        CAAP9390.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAACTGAACAGCCAGATGCTTGATGAACAAGCTTATCTACTTAATATAACTGAAGTGCAGCTGGTTTCTAGGTGTGATTATATTTTGCTAAAAATAAAGCAGTCAGATACAGCTCTTTTGGAAGACTCTCTAGAAGAAGAAGCTGAGCCTGAACTTGCAGCTGACTTGACATCAGAGCTTACCTTGCAGGATCCTGAGTTCCTCAAAGTAGGGCATGCTGGACCAATACAGGTTGGCCAAGTTGTCAAGAAGCCATACATTGTAAATATGCAGGAACCTCTTCCTGAAGTTTCTACATTTACTACAATTTCATATAAAGAGATGGATATGCAGTCAGAGGAGATTAGCAGTGTCCAGTCTTGTCCATCTGCTCCACTTACCAAAATTCCTGAAGCATCATGCAACTTGCAGCAGTGTCAATTCCTAAGGAAGATGGGCTCTAAAGGAAACATGCCTGGCATGTTTAACCTTCCAGTGAGTCTTCATGTTACTGCACTAGGGGAAGTGTTGGTGGCTGACAGAGGCAACTGCAGAATCCAGGTCTTTAACCGAAAAGGTTTCTTGAGAGAGATTAGGCGAAGCCCATCTGGAATTGACACTTTTGTGCTGAGCTTTCTTGGGGCAGATTTGCCCAATCTCATTCCATTATCGGTAACAATGAACTGTCATGGCCTTATAGGAGTGACAGACAATTATGATAATTCAGTGAAAGTGTATACAATGGAGGGACATTGTATAGCATGCCACAGAAGTCAGCTCAGCAAGCCTTGGGGCATTGCAGCTATGCCCTCGGGTCAGTTTGTGGTAACTGATNGTGAAGGAGGAAAGCTCTGGTGCCTAACCGTAGATCGCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)