Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 06 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ20250.3                           9 END     2          25       22                (no blast hit)
     2   2.0    0Xt7.1-CAAJ20250.5                           4 END     1          12       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 324.0    0Xt7.1-TEgg054j06.3.5                       67 PI      74        566     1263                PCTAIRE-motif protein kinase 2 [Xenopus tropicalis]
     4 438.0    0Xt7.1-CABI13235.3                          25 PI      77        557     1257                Unknown (protein for MGC:121139) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012088571 Xt7.1-CAAJ23138.5 - 8 ESTs
                                                                       ....-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ23138.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGGCATGTCACCGAAGCCTTTATAAAGGAGGAGTTAGCTCGCTTGAAAGGCTCTTAGCAGAGACGGGCGGGAGGCATTGGCACTGAGGGCTGCCTCTGGCGGCGCTTTCACCTGCTGTTGAGGTCCTGGGAGAAGCCGGCTGCCACCCCTCAGGCGCCCTGTTTGCAAACAGGGCAAAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAGCAAACTTACAGGGAACCTGGTAGCCCTAAAGGAAATCAGACTGGAACATGAGGAAGGAGCACCCTGCACAGCAATTAGAGAAGTTTCCCTTCTGAAGAATCTCAAACATTCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGATTTAAAACAGTACTTAGATAACTGTGGAAACCTCATGTGCATGCACAATGTCAAGATCTTCATGTTCCAGCTGCTTCGTGGTCTATCTTACTGTCACCGAAGGAAAATCCTGCACAGGGATCTTAAACCACAGAATTTGCTGATCAATGAGAAGGGAGAGTTAAAGCTGGCAGACTTTGGCCTTGCAAGAGCCAAGTCAGTACCCACAAAGACCTACTCCAACGAAGTGGTGACACTCTGGTACCGACCCCCTGATGTTCTGCTAGGTTCCACTGAGTACAGTACACCCATTGATATGTGGGGAGTTGGATGCATTCTGTATGAAATGGCAACAGGACGGCCTATGTTTCCAGGATCCACAGTGAAAGAGGAACTGCATTTAATATTCAGATTACTAGGAACCCCTACAGAGGAAACATGGCCAGGAATATGCTCTAATAAAGAGTTTAAAGGCTATGGCTTCCCTCAGTATCGAACGCAGCCTTTGAAAAATCATACTCCAAGGCTTGATTCAGATGGGATTGATCTACTTAGCAGTCTCTTGCTATATGAGGACAAAAAGAGAATCTCTGCAGACATGGGGCTCAGGCACGCGTATTTCAAAACCATGGGAGACCGAGTTCTCACTTTACCTGACAATGCATCAATCTTCACACTTAAAGAAATCCAACTACAAAAAGACCCAGGGCACCGTAGCTCCATTTTTCATCATGCAGCTCGTGGGAAGGCCAGAAGACAGAGCATATTTTAGAGGTGGCGCTGGATGAACAGAGAGCTCCCTGGAGAACCCTGCGCTTGATCCTTCTTCCCAAGACACTACTGCAGTGATACAGTATACACCTTTGAGTATTAGCTAGAACTTGCCCTGCTGCAGTGAGTCTTGTGCCAAATGTAATTAACTGGGTGTAGATGGTCATGTTCAGGGACCAAAGGAGAGTTAAGAGATGAGTTTCTTCTCTTCCAAACCCCACTAAAGCCTTATTTTAATTATATAGATCAAAAAAAGACAGAGTGAAATTACTCAGGGTGGAAATGGTGGTTCATGGTTGGTCCTTTTTGAACAGCAAAAACATTTCTGGGACTTCTAACACTGGATTC
                                                  Xt7.1-CHK-1008238645                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTCACCGAAGCCTTTATAAAGGAGGAGTTAGCTCGCTTGAAAGGCTCTTAGCAGAGACGGGCGGGAGGCATTGGCACTGAGGGCTGCCTCTGGCGGCGCTTTCACCTGCTGTTGAGGTCCTGGGAGAAGCCGGCTGCCACCCCTCAGGCGCCCTGTTTGCAAACAGGGCAAAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAGCAAACTTACAGGGAACCTGGTAGCCCTAAAGGAAATCAGACTGGAACATGAGGAAGGAGCACCCTGCACAGCAATTAGAGAAGTTTCCCTTCTGAAGAATCTCANACATTCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGATTTAAAACAGTACTTAGATAACTGTGGAAACCTCATGTGCATGCACAATGTCAAGATCTTCATGTTCCAGCTGCTTCGTGGTCTATCTTACTGTCACCGAAGGAAAATCCTGCACAGGGATCTTAAACCACAGAATTTGCTGATCAATGAGAAGGGAGAGTTAAAGCTGGCAGACTTTGGCCTTGCAAGAGCCAAGTCAGTACCCACAAAGACCTACTCCAACGAAGTGGTGACACTCTGGTACCGACCCCCTGATGTTCTGCTAGGTTCCACTGAGTACAGTACACCCATTGATATGTGGGGAGTTGGATGCATTCTGTATGAAATGGCAACAGGACGGCCTATGTTTCCAGGATCCACAGTGAAAGAGGAACTGCATTTAATATTCAGATTACTAGGAACCCCTACAGAGGAAACATGGCCAGGAATATGCTCTAATAAAGAGTTTAAAGGCTATGGCTTCCCTCAGTATCGAACGCAGCCTTTGAAAAATCATACTCCAAGGCTTGATTCAGATGGGATTGATCTACTTAGCAGTCTCTTGCTATATGAGGACAAAAAGAGAATCTCTGCAGACATGGGGCTCAGGCACGCGTATTTCAAAACCATGGGAGACCGAGTTCTCACTTTACCTGACAATGCATCAATCTTCACACTTAAAGAAATCCAACTACAAAAAGACCCAGGGCACCGTAGCTCCATTTTTCATCATGCAGCTCGTGGGAAGGCCAGAAGACAGAGCATATTTTAGAGGTGGCGCTGGATGAACAGAGAGCTCCCTGGAGAACCCTGCGCTTGATCCTTCTTCCCAAGACACTACTGCAGTGATACAGTATACACCTTTGAGTATTAGCTAGAACTTGCCCTGCTGCAGTGAGTCTTGTGCCAAATGTAATTAACTGGGTGTAGATGGTCATGTTCAGGGACCAAAGGAGAGTTAAGAGATGAGTTTCTTCTCTTCCAAACCCCACTAAAGCCTTATTTTAATTATATAGATCAAAAAAAGACAGAGTGAAATTACTCAGGGTGGAAATGGTGGTTCATGGTTGGTCCTTTTTGAACAGCAAAAACATTTCTGGGACTTCTAACACTGGATTCACACCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     196    1043                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     196     256                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     196     283                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     196      34                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Br ---- 5e-014     AAM92833.1 protein kinase C [Branchiostoma lanceolatum] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Bb ---- 2e-018     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Bf ==== 9e-024     AAM18889.1 unknown [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Cs ==== 2e-033     BAB68351.1 NEMO-like kinase [Ciona savignyi] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 5e-043     BAE06412.1 mitogen-activated protein kinase [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Sc ---- 2e-084     NP_015294.1 involved in phosphate and glycogen metabolism and cell cycle progression; Pho85p[Saccharomyces cerevisiae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 9e-091     XP_782022.1 PREDICTED: similar to CG10579-PD, isoform D [Strongylocentrotus purpuratus] -------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 3e-097     XP_694188.1 PREDICTED: similar to Serine/threonine-protein kinase PCTAIRE-3 (PCTAIRE-motif protein kinase 3), partial [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 2e-108     NP_001036582.1 Ecdysone-induced protein 63E CG10579-PH, isoform H [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 4e-133     NP_501372.1 PCTAIRE containing serine/threonine-protein kinase (65.5 kD) (pct-1) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Xl ---- 0          AAH43763.1 Similar to PCTAIRE protein kinase 2 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Gg ==== 0          XP_001234978.1 PREDICTED: hypothetical protein [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 0          NP_001093739.1 NUAK family, SNF1-like kinase, 1 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 0          NP_032821.1 PCTAIRE-motif protein kinase 3 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_002587.2 PCTAIRE protein kinase 3 isoform b [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          NP_001006837.1 PCTAIRE protein kinase 1 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ23138.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGA------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------TAG------------ATG------------------------------TGA---------------------------------------------------TAG---------------------TGA------------ATGTAA---------------------------------------------------------------------------------------------------------------------TGA---------------------------ATG------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   1           AbdN FL                     IMAGE:7006264.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGACACATGTATATCAACAGTAGGATGGGAGGGGTTTATGTCCTGAAGAGCTTGCAATCTGCCAATGACACGTTGCCTTCATTTGCAGAGAAGGGACAATCTGAGATCCTCCTATCATATCTACAAGACATTGATAAGAGATGCAGCAGATGCAACCCTCCCACACTTACCCTCACTCTGATTTCTACGGAGCCAGCCTGTACTTCTTTCTGCATTTTGCACAGCTAGCTCTCAGCCTGGCCAAATCCTTTTTACCTAATGCACAGATATCATAACAATCTCTGTCTTACTAATGAGAGCCTCACTTGCTAAAGCCTGATACACAGACAGTGTTTATGATGCCTCTCTGATTCAATGCACAGCTTCTTCATTTCATTCCACATCCAGGCACATACAGGTTGCCTTTGTTTTTCCCAGAGCCTTCCCACATTTACACTCCACCGTTCTCTTTAACCTTCAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAGCAAACTTACAGGGAACCTGGTAGCCCTAAAGGAAATCAGACTGGAACATGAGGAAGGAGCACCCTGCACAGCAATTAGAGAAGTTTCCCTTCTGAAGAATCTCAAACATTCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGATTTAAAACAGTACTTAGATAACTGTGGAAACCTCATGTGCATGCACAATGTCAAGATCTTCATGTTCCAGCTGCTTCGTGGTCTATCTTACTGTCACCGAAGGAAAATCCTGCACAGGGATCTTAAACCACAGAATTTGCTGATCAATGAGAAGGGAGAGTTAAAGCTGGCAGACTTTGGCCTTGCAAGAGCCAAGTCAGTACCCACAAAGACCTACTCCAACGAAGTGGTGACACTCTGGTACCGACCCCCTGATGTTCTGCTAGGTTCCACTGAGTACAGTACACCCATTGATATGTGGGGAGTTGGATGCATTCTGTATGAAATGGCAACAGGACGGCCTATGTTTCCAGGATCCACAGTGAAAGAGGAACTGCATTTAATATTCAGATTACTAGGAACCCCTACAGAGGAAACATGGCCAGGAATATGCTCTAATAAAGAGTTTAAAGGCTATGGCTTCCCTCAGTATCGAACGCAGCCTTTGAAAAATCATACTCCAAGGCTTGATTCAGATGGGATTGATCTACTTAGCAGTCTCTTGCTATATGAGGACAAAAAGAGAATCTCTGCAGACATGGGGCTCAGGCACGCGTATTTCAAAACCATGGGAGACCGAGTTCTCACTTTACCTGACAATGCATCAATCTTCACACTTAAAGAAATCCAACTACAAAAAGACCCAGGGCACCGTAGCTCCATTTTTCATCATGCAGCTCGTGGGAAGGCCAGAAGACAGAGCATATTTTAGAGGTGGCGCTGGATGAACAGAGAGCTCCCTGGAGAACCCTGCGCTTGATCCTTCTTCCCAAGACACTACTGCAGTGATACAGTATACACCTTTGAGTATTAGCTAGAACTTGCCCTGCTGCAGTGAGTCTTGTGCCAAATGTAATTAACTGGGTGTAGATGGTCATGTTCAGGGACCAAAGGAGAGTTAAGAGATGAGTTTCTTCTCTTCCAAACCCCACTAAAGCCTTATTTTAATTATATAGATCAAAAAAAGACAGAGTGAAATTACTCAGGGTGGAAATGGTGGTTCATGGTTGGTCCTTTTTGAACAGCAAAAACATTTCTGGGACTTCTAACACTGGATTCACACCACTGAATTCTGTGCTCTCACATTCCACAGATCAAAAATAGTATTAAAATGAACAGCAACACTCCTTCCTTTTTTCACCACAGATCTAAGCCAAGGAGATGGTGGTGTCTTCCGCTCTTAAAATATTTTCTTATTGTATCCTTTTATACCTAAAGATGCATTCCAAATTATATTAACCATATGGTGGAAACAAATAAGGCTGGTGCCTCAAATATATTTTTACAGTTTTATCATTACACAGAAAGGCATACAGGAAGCATGAAAGTAACATAGTGCAGATTCCAGGTGCCATGTTGTGACACAGTGCCACATATCCCATGTAAATTGGTGATAACCTGGGATACTGGGCTATATAGGGATAGCAGCATTTACATGTTTTAACAATTGTTTTTAAATGTGAAAAATAGAAAGATATTGTCTAGCAAATATTTTTCACAAAATGGGAAATGCACACCAACCATCCCACCAAACTTTGCTCTGTGAGGCCTTTATAGTAAAAACATTTTGTGTGTTTGATTCTCTGGTAAGATTGGTACCATGTGAGGTGGGATGATGCTTAAAGTTTTCATATTGCACTATAAGACTTAAAGGTCAGCCCTTGCCATGCATATTGTCCTTGCCACTGAACATTGTGAGCCTGCTGAATTCAGTAACAAAATATGTGACTAATGGTATGCCATTTATTAATTTTATAATGGCATTCATCATACACTGATTGATCAAACCATAACAAAAGGTTACATAGCCACCAAGCCATTATGATTGGTTCCAGATTTGAAACATGAGCTAAAGGTTAAAGTAAAATCTGATGACAGTGAACTTGTTCCACCTACATGTATGTATAACATTATTTATAAAGCTTGACATGGAAATGTAGTGCTGTAAAACAATTACACACAGGTTTGACAAGTATTATAATAAATAAAATAAACAAGTATAAATTTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld AbdN FL                            IMAGE:7006264                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGACACATGTATATCAACAGTAGGATGGGAGGGGTTTATGTCCTGAAGAGCTTGCAATCTGCCAATGACACGTTGCCTTCATTTGCAGAGAAGGGACAATCTGAGATCCTCCTATCATATCTACAAGACATTGATAAGAGATGCAGCAGATGCAACCCTCCCACACTTACCCTCACTCTGATTTCTACGGAGCCAGCCTGTACTTCTTTCTGCATTTTGCACAGCTAGCTCTCAGCCTGGCCAAATCCTTTTTACCTAATGCACAGATATCATAACAATCTCTGTCTTACTAATGAGAGCCTCACTTGCTAAAGCCTGATACACAGACAGTGTTTATGATGCCTCTCTGATTCAATGCACAGCTTCTTCATTTCATTCCACATCCAGGCACATACAGGTTGCCTTTGTTTTTCCCAGAGCCTTCCCACATTTACACTCCACCGTTCTCTTTAACCTTCAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCCTAAGCCGGTTGCTAAGAAAGAGCTTCTCTGTCCCGATATTGGGGTTTGGGAAAATTGGAGACGTACATAAAGCTGGGACAAACTANNGAGAGGGAAACCCTATGCCACTGTTCTTTCAAGGGTTCGNCAGCAAAACTTACGG
  5   1   2       bld BrSp 5x3  out                     EC2BBA6DB06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGTTTTCCAAGGATAGGCAATTGCCTGGCATGTCACCGAAGCCTTTATAAAGGAGGAGTTAGCTCGCTTGAAAGGCTCTTAGCAGAGACGGGCGGGAGGCATTGGCACTGAGGGCTGCCTCTGGCGGCGCTTTCACCTGCTGTTGAGGTCCTGGGAGAAGCCGGCTGCCACCCCGCAGGCGCCCTGTTTGCAAACAGGGCAAAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAACAA
  5   1   2      seed Brn2      in                        CAAJ23138.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGGCATGTCACCGAAGCCTTTATAAAGGAGGAGTTAGCTCGCTTGAAAGGCTCTTAGCAGAGACGGGCGGGAGGCATTGGCACTGAGGGCTGCCTCTGGCGGCGCTTTCACCTGCTGTTGAGGTCCTGGGAGAAGCCGGCTGCCACCCCTCAGGCGCCCTGTTTGCAAACAGGGCAAAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAGCAAACTTACAGGGAACCTGGTAGCCCTAAAGGAAATCAGACTGGAACATGAGGAAGGAGCACCCTGCACAGCAATTAGAGAAGTTTCCCTTCTGAAGAATCTCANACATTCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGA
  5   1   2   14  bld Brn2 5g3  out                       CAAJ22708.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGGCATTGGCACTGAGGGCTGCCTCTGGCGGCGCTTTCACCTGCTGTTGAGGTCCTGGGAGAAGCCGGCTGCCACCCCTCAGGCGCCCTGTTTGCAAACAGGGCAAAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTCCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAGCAAACTTACAGGGAACCTGGTAGCCCTAAAGGAAATCAGACTGGAACATGAGGAAGGAGCACCCTGCACAGCAATTAGAGAAGTTTCCCTTCTGAAGAATCTCANACATTCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGATTTAAAACAGTACTT
  5   1   2   14  bld Te3  5g3  out                         CAAM509.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAAGCCGGCTGCCACCCCTCAGGCGCCCTGTTTGCAAACAGGGCAAAGGTCAGCACCATCACCATGAACAAGGTGAAGAATTTTAAGCGTCGATTCTCCCTCTCTGTCCCTCGGCCAGAAACTATTGAGGAATATAATCAGCTGAATAGCCGGTGCGGTGAAGGCCTTGGTCATTCCCACCTGCAGGTGGCACAGCTGAGCCCAGGAAATGCTGCCTTGTCTCCATCAGATGGTGAGGGTTTGTCTTCGACTGCACTGAGTTATAGGAAGACTGTTCAGCGCCGTCTCTCCATGGAAGATGTCAGCAAGAGGCTTTCTTTACCGATGGACATCCGCTTGCCCCCAGAACTTCTAGACAAGCTGCAAATGAACAGTCCAGATGATGATCCAAAGCCCCTAAGCCGGTTGCTAAGAAGAGCTTCTCTGTCCGATATTGGGTTTGGAAAATTGGAGACGTACATAAAGCTGGACAAACTAGGAGAGGGAACCTATGCCACTGTCTTCAAGGGTCGCAGCAAACTTACAGGGAACCTGGTAGCCCTAAAGGAAATCAGACTGGAACATGAGGAAGGAGCACCCTGCACAGCAATTAGAGAAGTTTCCCTTCTGAAGAATCTCAAACATTCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGATTTAAAACAGTACTTAGATAACTGTGG
  3   1   2       bld Brn2      in                        CAAJ23138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAATCTCAAACATCCCAACATTGTAACACTGCATGACATCATCCACACAGAATACTGTCTCACTCTTGTATTCGAGTACTTGGACAGTGATTTAAAACAGTACTTAGATAACTGTGGAAACCTCATGTGCATGCACAATGTCAAGATCTTCATGTTCCAGCTGCTTCGTGGTCTATCTTACTGTCACCGAAGGAAAATCCTGCACAGGGATCTTAAACCACAGAATTTGCTGATCAATGAGAAGGGAGAGTTAAAGCTGGCAGACTTTGGCCTTGCAAGAGCCAAGTCAGTACCCACAAAGACCTACTCCAACGAAGTGGTGACACTCTGGTACCGACCCCCTGATGTTCTGCTAGGTTCCACTGAGTACAGTACACCCATTGATATGTGGGGAGTTGGATGCATTCTGTATGAAATGGCAACAGGACGGCCTATGTTTCCAGGATCCACAGTGAAAGAGGAACTGCATTTAATATTCAGATTACTAGGAACCCCTACAGAGGAAACATGGCCAGGAATATGCTCTAATAAAGAGTTTAAAGGCTATGGCTTCCCTCAGTATCGAACGCAGCCTTTGAAAAATCATACTCCAAGGCTTGATTCAGATGGGATTGATCTACTTAGCAGTCTCTTGCTATATGAGGACAAAAAGAGAATCTCTGCAGACATGGGGCTCAGGCACGCGTATTTCAAAACCATGGGAGACCGAGTTCTCACTTTACCTGACAATGCATCAATCTTCACACTTAAAGAAATCCAACTAC
  5   1   2      skin Brn3      out                        CAAK1426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCTGATGTTCTGCTAGGTTCCACTGAGTACAGTACACCCATTGATATGTGGGGAGTTGGATGCATTCTGTATGAAATGGCAACAGGACGGCCTATGTTTCCAGGATCCACAGTGAAAGAGGAACTGCATTTAATATTCAGATTACTAGGAACCCCTACAGAGGAAACATGGCCAGGAATATGCTCTAATAAAGAGTTTAAAGGCTATGGCTTCCCTCAGTATCGAACGCAGCCTTTGAAAAATCATACTCCAAGGCTTGATTCAGATGGGATTGATCTACTTAGCAGTCTCTTGCTATATGAGGACAAAAAGAGAATCTCTGCAGACATGGGGCTCAGGCACGCGTATTTCAAAACCATGGGAGACCGAGTTCTCACTTTACCTGACAATGCATCAATCTTCACACTTAAAGAAATCCAACTACAAAAAGACCCAGGGCACCGTAGCTCCATTTTTCATCATGCAGCTCGTGGGAAGGCCAGAAGACAGAGCATATTTTAGAGGTGGCGCTGGATGAACAGAGAGCTCCCTGGAGAACCCTGCGCTTGATCCTTCTTCCCAAGACACTACTGCAGTGATACAGTATACACCTTTGAGTATTAGCTAGAACTTGCCCTGCTGCAGTGAGTCTTGTGCCAAATGTAATTAACTGGGTGTAGATGGTCATGTTCAGGGACCAAAGGAGAGTTAAGAGATGAGTTTCTTCTCTTCCAAACCCCACTAAAGCCTTATTTTAATTATATAGATCANAAAAAGACAGAGTGAAATTACTCAGGGTGGAAATGGTGGTTCATGGTTGGTCCTTTTTGAACAGCNAAAACATTTCTGGGACTTCTAACACTGGATTCACACCACT
  5   1   2      skin Brn2                                CAAJ20202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGCAATCTTCACACTTAAAGAAATCCAACTACAAAAAGACCCAGGGCACCGTAGCTCCATTTTTCATCATGCAGCTCGTGGGAAGGCCAGAAGACAGAGCATATTTTAGAGGTGGCGCTGGATGAACAGAGAGCTCCCTGGAGAACCCTGCGCTTGATCCTTCTTCCCAAGACACTACTGCAGTGATACAGTATACACCTTTGAGTATTAGCTAGAACTTGCCCTGCTGCAGTGAGTCTTGTGCCAAATGTAATTAACTGGGTGTAGATGGTCATGTTCAGGGACCAAAGGAGAGTTAAGAGATGAGTTTCTTCTCTTCCAAACCCCACTAAAGCCTTATTTTAATTATATAGATCAAAAAAAGACAGAGTGAAATTACTCAGGGTGGAAATGGTGGTTCATGGTTGGTCCTTTTTGAACAGCAAAAACATTTCTGGGACTTCTAACACTGGATTCACACCACTGAATTCTGTGCTCTCACATTCCACAGATCAAAAATAGTATTAAAATGAACAGCAACACTCCTTCCTTTTTTCACCACAGATCTAAGCCAAGGAGATGGTGGTGTCTTCCGCTCTTAAAATATTTTCTTATTGTATCCTTTTATACCTAAAGATGCATTCCAAATTATATTAACCATATGGTGGAAACAAATAAGGCTGGTGCCTCAAATATATTTTTACAGTTTTATCATTACACAGAAAGGCATACAGGAAGCATGAAAGTAACATAGTGCAGATTCCAGGTGCCATGTTGTGACACAGTGCCACATATCCCATGTAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)