Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA078c06.3                         90 END     1          20        1                desmoplakin isoform II [Homo sapiens]

 This cluster: approximate FL confidence score = 84%

 1012088993 Xt7.1-CABJ8679.5 - 5 ESTs
                                                                       .....-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ8679.5                                                                                                                              AGTGAGTCTGAATAAATAGCAGCCCGCTAGCTTCCCACTTACACTTCTGCACTGCTGCTTTGTACTGCTTGTCCGTAGCGCTTCTGCCTTGTCTGCACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGACTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTCTAAAGCCCCTGATGGAGAAAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGCCATGGTGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGCGGCCTACGGGCAATATACACCAGTAATAACATGTATTTATTTCTTGTAAATAAGTCCCCACACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACACAGGGCACGAAAGTGACCCTCTTTGTGAACCCAAAGGGTTTAAATTAGTATGCGATTTGCATTTTACATTAACCCGTGGACTG
                                                  Xt7.1-CHK-1008242188                                                                                                                                    TCTGAATAAATAGCAGCCCGCTAGCTTCCCACTTACACTTCTGCACTGCTGCTTTGTACTGCTTGTCCGTAGCGCTTCTGCCTTGTCTGCACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGACTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTCTAAAGCCCCTGATGGAGAAAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGCCATGGTGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGCGGCCTACGGGCAATATACACCAGTAATAACATGTATTTATTTCTTGTAAATAAGTCCCCACACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACACAGGGCACGAAAGTGACCCTCTTTGTGAACCCAAAGGGTTTAAATTAGTATGCGATTTGCATTTTACATTAACCCGT
                                                      consensus depths                                                                                                                                   2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN      66      45                                                                                                                              
                                               BLH MPR      63      45                                                                                                                              
                                               BLH OVR      99     227                                                                                                                              
                                               ORF LNG      99       6                                                                                                                              
                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 5e-010     NP_500281.1 abnormal cell LINeage LIN-22, Helix Loop Helix containing protein,antero-posterior patterning factor, hairy and enhancer of split homolog (19.5kD) (lin-22) [Caenorhabditis elegans] ==========
                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-017     NP_476923.1 deadpan CG8704-PA [Drosophila melanogaster] ------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 5e-021     BAE06388.1 transcription factor protein [Ciona intestinalis] ================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sp ---- 2e-020     NP_001001768.1 hairy and enhancer of split [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 9e-022     NP_001005848.1 c-hairy1B [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                       PROTEIN -== Bf ==== 9e-026     AAQ93671.1 hairy E protein [Branchiostoma floridae] ================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 2e-024     NP_001082574.1 basic-helix-loop-helix transcription factor hairy2 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                     PREDICTED - Xt ---- 6e-025     NP_988870.1 hypothetical protein MGC75875 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ==== 5e-034     NP_032262.2 hairy and enhancer of split 2 [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ==== 2e-035     NP_061962.2 hairy and enhancer of split homolog 2 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                       PREDICTED = Dr ==== 2e-041     XP_687555.1 PREDICTED: similar to Transcription factor HES-2 (Hairy and enhancer of split 2) [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 3e-102     AAH84134.1 LOC495039 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ8679.5                                                                                                                                          TAA------------TAG---------------------------------------------TAG---------------------ATG---------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------TAA---------------------------------------ATG------------------------------ATG------TGA
                                                                   ORF                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  0   1   1           Te3  FL                          CAAM1980.FL-MGC GAAGTGCGAGGATGCTGCCAGTGCCACTCACCTACCTGTGGCACAGCAGATGGCTGTTGGGAATGAAAGCGCTGGGCGGAGGGGGCGTATCCTCCGAAAGGAGTCTGTTGGGCGGAGCCACGCCGAGTGAGTCTGAATAAATAGCAGCCCGCTAGCTTCCCACTTACACTTCTGCACTGCTGCTTTGTACTGCTTGTCCGTAGCGCTTCTGCCTTGTCTGCACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGACTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTCTAAAGCCCCTGATGGAGAAAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGCCATGGTGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGCGGCCTACGGGCAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   15  bld Te3  FL   in                         CAAM1980.5p ..AGTGCGAGGATGCTGCCAGTGCCACTCACCTACCTGTGGCACAGCAGATGGCTGTTGGGAATGAAAGCGCTGGGCGGAGGGGGCGTATCCTCCGAAAGGAGTCTGTTGGGCGGAGCCACGCCGAGTGAGTCTGAATAAATAGCAGCCCGCTAGCTTCCCACTTACACTTCTGCACTGCTGCTTTGTACTGCTTGTCCGTAGCGCTTCTGCCTTGTCTGCACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGACTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTCTAAAGCCCCTGATGGAGAAAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGGCATGGTGAACGGTTAACTTGGACTTTGTACTCT
  3   1   2       bld Te3  FL   in                         CAAM1980.3p                                                                                                                              AGTGAGTCTGAATAAATAGCAGCCCGCTAGCTTCCCACTTACACTTCTGCACTGCTGCTTTGTACTGCTTGTCCGTAGCGCTTCTGCCTTGTCTGCACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGACTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTCTAAAGCCCCTGATGGAGAAAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGCCATGGTGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGCGGCCTACGGGCAATAT
  5   1   2   10 seed Ski1 PIPE in                         CABJ8679.5p ....................................................................................................................................................................................................................CTTGTCTGCACCATGGCTCCCAATGTAGCGCTCGCAGACTCCATGCACAACTACCAGCCCAAGACTGGCAAGAGGAATCAGGAGGCCAGTGAGCTAAGAAAGACTCTAAAGCCCCTGATGGAGAAAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGCCATGGTGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGCGGCCTACGGGCAATATACACCAGTAATAACATGTATTTATTTCTTGTAAATAAGTCCCCACACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACACAGGGCACGAAAGTGACCCTCTTTGTGAACCCAAAGGGTTTAAATTAGTATGCGATTTGCATTTTACATTAACCCGTGGACTGCCAG
  5   1   2       bld Ski1      out                        CABJ8583.5p                                                                                                                                                                                                                                                                                                                                                 AAAGGAGAAGGGCGAGAATTAACGAAAGTCTAAACCAAGTGAGAACCCTCATCCTGCCGCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCAGAGAGGCGAGCTACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTCCTTCATGTGAGACCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCTGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGGCATGGCGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGAGGCCTACGGGCAATATACACCAGTAATAACATGTATTTATTTCTTGTAGATAAGTCCCCACACCTGAAATCCTGAATTA
  3   1   2       bld Ski1 PIPE in                         CABJ8679.3p                                                                                                                                                                                                                                                                                                                                                                   TTAACGAAAGTCTAAACCAACTGAAAACCCTCATCCTGCGNCTCATTGGGAAAGATAATTCCCGATACTCCAAGCTGGAAAAAGCTGATATCTTGGAAATGACAGTGAGATTCCTCAGGGACATCCCTCCGGTCCCAGCACAAAATCCCGCAGATCGCTATAAGGAAGGCTACAGAGCATGTGTGGAGCGCCTGAGCGCAATCCTTAATAAATCCCATGTGCTGACCGGAGAGGCGAGCAACCGCCTACTAAATCACCTGCAGAGGAGCCCAGAGCTGTGCTGCTCAGACTGCCATCATCCCCCCAAGTCCCACAGCCCTAGGATTGTTCTTCATGTGAGTCCCAGAACATCCCAGCTCGAATCTCCTCTCCTGAACCAGCCCTCCAGCCACAGGCCTGCCCCATGCCCCCCGCAACTCAACAGCTCCATCTGGAGGCCATGGTGAACGGTTAACTTGGACTTTGTACTCTCGCAAAGACTGTAACAATGCAGCGGCCTACGGGCAATATACACCAGTAATAACATGTATTTATTTCTTGTAAATAAGTCCCCACACATGAAATCCTGACTTACTAAAGGCAATATATTTTGGACAAATAGTCCTGAATACACAGGGCACGAAAGTGACCCTCTTTGTGAACCCAAAGGGTTTAAATTAGTATGCGATTTGCATTTTACATTAACCCGTGGACTGCCAGAGCGGGTCAATACTACAGTCCGTGTTTTGTGTTGGGTCTCCTGGCAGCCCACGGGTATAATGACACAGGGCTATGTGCAACAATAATGCCTGGACATGAACACTGTTGCCAGCACTTTTTTATTTAATGTTTGTAATTAAATCTTTTATTTTTAAAATAAAATCCTAAAATGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)