Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xt7.1-CABG9567.3                            7 END     3          37       42                PREDICTED: hypothetical protein [Gallus gallus]

 This cluster: approximate FL confidence score = 97%

 1012089158 Xt7.1-ANBT1197.5 - 8 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-ANBT1197.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGAAGCAGGACTGGGAGGATTAAGTGGTATGCAAGGGCCAGAAGACGGCAATAAGAGAAGGATCCTGTTAGTACATGGAATAGGAGGCAGCCAATGAAAATGGTTATGAGAAAAAAAGCAACAGCCCAGCAAGAACAGTGGGCATCAGAAACAGGGGAGGAAGAACCAAGCAAGCAGAACCATGCTCAGAAGGTGCTGAATACGGTGACTGGGCTCGTACAGTCTGTACGCAATAGAAATGTCACTGAAAATGACTCAGGAGACCACCATGAAATATTGCTGCATAAAGAAATGGCCTTTCATGACGCTGCTAAAAAGGATGATGTGCTAGCCATGACTCGGCTGCTGGAACAAAAAGCTAACATTAATGCCAAGAATAATCTCAACAGGACAGCGCTTCACTTTGCTGTAGCTGCAAATAAAATGCAGGCCGTGTCCTTCCTCCTGAGCCACAAAGCACGAGTAGATATTGCTGATAAGCATGGCCTGACTGTTCTTCACCTGGCGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAGCTCAGAATGATAAGAACGACATTGTGGAATATCTTATTAAAGATCTGCAGCTGAAAGACTTAAATATTCTTGATAAGAAGAAAAGAAAACCATTTCATTTGGCTGCTGAAAAGGGACATATCGACATGGTTACTAAACTCATTGAGTTTGAACTCTTCACTCTGGAAAAAGACAAGGAGGGTAACACAGCTCTTCACTACGCAGCAAAAAATGGCCATGACAGTGTTGTTGAGACTCTTCTGGAAATATGGAAAGAAAATGAAATAGATGAGCCAAATGAGAGTGGGGCAACGCCGTTCTACCTGGCAGCTGGAGGAGGCCACGTGGCTTGTGCAGAATTACTATTGCATAAAGGAAGCAATATCAACACTACAAC
                                                  Xt7.1-CHK-1008238480                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGACTGGGAGGATTAAGTGGTATGCAAGGGCCAGAAGACGGCAATAAGAGAAGGATCCTGTTAGTACATGGAATAGGAGGCAGCCAATGAAAATGGTTATGAGAAAAAAAGCAACAGCCCAGCAAGAACAGTGGGCATCAGAAACAGGGGAGGAAGAACCAAGCAAGCAGAACCATGCTCAGAAGGTGCTGAATACGGTGACTGGGCTCGTACAGTCTGTACGCAATAGAAATGTCACTGAAAATGACTCAGGAGACCACCATGAAATATTGCTGCATAAAGAAATGGCCTTTCATGACGCTGCTAAAAAGGATGATGTGCTAGCCATGACTCGGCTGCTGGAACAAAAAGCTAACATTAATGCCAAGAATAATCTCAACAGGACAGCGCTTCACTTTGCTGTAGCTGCAAATAAAATGCAGGCCGTGTCCTTCCTCCTGAGCCACAAAGCACGAGTAGATATTGCTGATAAGCATGGCCTGACTGTTCTTCACCTGGCGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAGCTCAGAATGATAAGAACGACATTGTGGAATATCTTATTAAAGATCTGCAGCTGAAAGACTTAAATATTCTTGATAAGAAGAAAAGAAAACCATTTCATTTGGCTGCTGAAAAGGGACATATCGACATGGTTACTAAACTCATTGAGTTTGAACTCTTCACTCTGGAAAAAGACAAGGAGGGTAACACAGCTCTTCACTACGCAGCAAAAAATGGCCATGACAGTGTTGTTGAGACTCTTCTGGAAATATGGAAAGAAAATGAAATAGATGAGCCAAATGAGAGTGGGGCAACGCCGTTCTACCTGGCAGCTGGAGGAGGCCACGTGGCTTGTGCAGAATTACTATTGCATAAAGGAAGCAATATCAACACTACAACACATGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     4     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     148      47                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      94     882                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      94      64                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 7e-013     NP_014677.1 Protein involved in constitutive endocytosis of Ste3p; Akr2p [Saccharomycescerevisiae] -----------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bf ---- 6e-014     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 2e-016     BAE06328.1 Ci-Bcl3 [Ciona intestinalis] -------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xt ---- 1e-020     CAJ82018.1 ankyrin repeat domain 28 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 3e-023     NP_500898.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 5e-026     NP_648148.1 CG7462-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 1e-028     AAH70767.1 LOC431863 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 3e-029     XP_001198470.1 PREDICTED: similar to ankyrin 2,3/unc44 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 6e-032     XP_429150.2 PREDICTED: hypothetical protein [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 2e-032     XP_691148.1 PREDICTED: similar to death associated protein kinase 1 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 3e-048     XP_697739.1 PREDICTED: similar to receptor-interacting serine-threonine kinase 4 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Hs ---- 1e-059     XP_001128459.1 PREDICTED: similar to ankyrin 3, epithelial isoform b [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Mm ==== 2e-064     NP_001036179.1 hypothetical protein LOC271144 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-ANBT1197.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGA------------------------------------------------TAA---------------------------------------ATG---ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ...
  5   1   2      seed TbA  5g                        TTbA005f13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGACACATCAGAGAGTGAAGCAGGACTGGGAGGATTAAGTGGTATGCAAGGGCCAGAAGACGGCAATAAGAGAAGGATCCTGTTAGTACATGGAATAGGAGGCAGCCAATGAAAATGGTTATGAGAAAAAAAGCAACAGCCCAGCAAGAACAGTGGGCATCAGAAACAGGGGAGGAAGAACCAAGCAAGCAGAACCATGCTCAGAAGGTGCTGAATACGGTGACTGGGCTCGTACAGTCTGTACGCAATAGAAATGTCACTGAAAATGACTCAGGAGACCACCATGAAATATTGCTGCATAAAGAAATGGCCTTTCATGACGCTGCTAAAAAGGATGATGTGCTAGCCATGACTCGGCTGCTGGAACAAAAAGCTAACATTAATGCCAAGAATAATCTCAACAGGACAGCGCTTCACTTTGCTGTAGCTGCAAATAAAATGCAGGCCGTGTCCTTCCTCCTGAGCCACAAAGCACGAGTAGATATTGCTGATAAGCATGGCCTGACTGTTCTTCACCTGGCGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAGCTCAGAATGATAAGAACGACATTGTGGAATATCTTATTAAAGATCTGCAGCTGAAAGACTTAAATATTCTTGATAAGAAGAAAAGAAAACCATTTCATTTGGCTGCTGAAAAGGGACATATCGACATGGTTACTAAACTCATTGAGTTTGAACTCTTCACTCTGGGAAAAGACAAGGAGGGTAACACAGCTCTTCACTACGCAGCAA
  5   1   2       bld Neu0 PIPE out                    NISC_ng05g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACATCAGAGAGTGAAGCAGGACTGGGAGGATTAAGTGGTATGCAAGGGCCAGAAGACGGCAATAAGAGAAGGATCCTGTTAGTACATGGAATAGGAGGCAGCCAATGAAAATGGTTATGAGAAAAAAAGCAACAGCCCAGCAAGAACAGTGGGCATCAGAAACAGGGGAGGAAGAACCAAGCAAGCAGAACCATGCTCAGAAGGTGCTGAATACGGTGACTGGGCTCGTACAGTCTGTACGCAATAGAAATGTCACTGAAAATGACTCAGGAGACCACCATGAAATATTGCTGCATAAAGAAATGGCCTTTCATGACGCTGCTAAAAAGGATGATGTGCTAGCCATGACTCGGCTGCTGGAACAAAAAGCTAACATTAATGCCAAGAATAATCTCAACAGGACAGCGCTTCACTTTGCTGTAGCTGCAAATAAAATGCAGGCCGTGTCCTTCCTCCTGAGCCACAAAGCACGAGTAGATATTGCTGATAAGCATGGCCTGACTGTTCTTCACCTGGCGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAG
  5   1   2       bld Tbd1      in                          CBXT932.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGAGTGAAGCAGGACTGGGAGGATTAAGTGGCATGCAAGGGCCAGAAGACGGCAATAAGAGAAGGATCCTGTTAGTACATGGAATAGGAGGCAGCCAATGAAAATGGTTATGAGAAAAAAAGCAACAGCCCAGCAAGAACAGTGGGCATCAGAAACAGGGGAGGAAGAACCAAGCAAGCAGAACCATGCTCAGAAGGTGCTGAATACGGTGACTGGGCTCGTACAGTCTGTACGCAATAGAAATGTCACTGAAAATGACTCAGGAGACCACCATGAAATATGTAAGTGTATATATATATATATATATATATATATGCTCAGGGATATGTGTGTGTGTGTGTATATGTGTATGTTTGCACTAAATAGGGTATGCTTAAACAGGTTGGTGCACAAAGTTGTTTTTTTGCATAAAGGTAGAATACCTCAGCAAAATAGATTCATTAAAGTTATTTATAAATGTAATTACTACCGAATGCAGTTTATGTAATAGGAGTCTGCTCCAGGTCTGTTAATCAGAGCGTTTGCAACATGTTGCAGTTGTGCAGAGAATATCAGCAGCCCAGACACCTTACAATTACAAATAACTTTAAAACCATTAAAAATGATTTAATTTCATTTATAAACTAAATGTTCTTTTATGCATTCTCAGATCATTAAAAGTCTATAAAACCAAAAAAAAAAAAAAAGGGCGGGCCG
  5   1   2       bld Gas6      in                         ANBT1197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGGACTGGGAGGATTAAGTGGCATGCAAGGGCCAGAAGACGGCAATAAGAGAAGGATCCTGTTAGTACATGGAATAGGAGGCAGCCAATGAAAATGGTTATGAGAAAAAAAGCAACAGCCCAGCAAGAACAGTGGGCATCAGAAACAGGGGAGGAAGAACCAAGCAAGCAGAACCATGCTCAAAAGGTGCTGAATACGGTGACTGGGCTCGTACAGTCTGTACGCAATAGAAATGTCACTGAAAATGACTCAGGAGACCACCATGAAATATTGCTGCATAAAGAAATGGCCTTTCATGACGCTGCTAAAAAGGATGATGTGCTAGCCATGACTCGGCTGCTGGAACAAAAAGCTAACATTAATGCCAAGAATAATCTCAACAGGACAGCGCTTCACTTTGCTGTAGCTGCAAATAAAATGCAGGCCGTGTCCTTCCTCCTGAGCCACAAAGCACGAGTAGATATTGCTGATAAGCATGGCCTGACTGTTCTTCACCTGGCGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAGCTCAGAATGATAAGAACGACATTGTGGAATATCTTATTAAAGATCTGCAGCTGAAAGACTTAAATATTCTTGATAAGAAGAAAAGAAAACCATTTCATTTGGCTGCTGAAAAGGGACATATCGACATGGTTACTAAACTCATTGAGTTTGAACTCTTCACTCTGGAAAAAGACAAGGAGGGTAACACAGCTCTTCACTACGCAGCAAAAAATGGCCATGACAGTGTTGTTGAGACTCTTCTGGAATATGGAAAGAAATGAAATAGATGAGCCAAATG
  3   1   2       bld Gas6      in                         ANBT1197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTGCTAGCCATGACTCGGCTGCTGGAACAAAAAGCTAACATTAATGCCAAGAATAATCTCAACAGGACAGCGCTTCACTTTGCTGTAGCTGCAAATAAAATGCAGGCCGTGTCCTTCCTCCTGAGCCACAAAGCACGAGTAGATATTGCTGATAAGCATGGCCTGACTGTTCTTCACCTGGCGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAGCTCAGAATGATAAGAACGACATTGTGGAATATCTTATTAAAGATCTGCAGCTGAAAGACTTAAATATTCTTGATAAGAAGAAAAGAAAACCATTTCATTTGGCTGCTGAAAAGGGACATATCGACATGGTTACTAAACTCATTGAGTTTGAACTCTTCACTCTGGAAAAAGACAAGGAGGGTAACACAGCTTTTCACTACGCAGCAAAAAATGGCCATGACAGTGTTGTTGAGACTCTTCTGGAAATATGGAAAGAAAATGAAATAGATGAGCCAAATGAGAGTGGGGCAACGCCGTTCTACCTGGCAGCTGGAGGAGGGCACGTGGCTTGTGCAGAATTACTATTGCATAAAGGAAGCAATATCAACACTACAACACATGTATGTTCTGCTGATTCACTGGCTTTTCATTAAATAAATAATAGAAGTTAT
  3   1   2      skin Tbd1      in                          CBXT932.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTGTATATGTGTATGTTTGCACTAAATAGGGTATGCTTAAACAGGTTGGTGCACAAAGTTGTTTTTTTGCATAAAGGTAGAATACCTCAGCAAAATAGATTCATTAAAGTTATTTATAAATGTAATTACTACCGAATGCAGTTTATGTAATAGGAGTCTGCTCCAGGTCTGTTAATCAGAGCGTTTGCAACATGTTGCAGTTGTGCAGAGAATATCAGCAGCCAGACACCTTACAATTACAAATAACTTTAAAACCATTAAAAATGATTTAATTTCATTTATAAACTAAATGTTCTTTATGCATTCTCAGATCATTAAAAGTCTATAAAACCAAAAAAAAAAAAAAA
  5   1   2       bld Gas1      out                      IMAGE:6990857                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTGATAAGCATGGCCTGACTGTTCTTCACCTGTTGGCATGGTCTGCAGATCTGACTATTGTACAAATGCTGATCAAAGCAGGGATCAGCCAAAAGGCTACTAATCAGGATGGAATGAATGTCTTGCATTTTGCAGCTCAGAATGATAAGAACGACATTGTGGAATATCTTATTAAAGATCTGCAGCTGAAAGACTTAAATATTCTTGATAAGAAGAAAAGAAAACCATTTCATTTGGCTGCTGAAAAGGGACATATCGACATGGTTACTAAACTCATTGAGTTTGAACTCTTCACTCTGGAAAAAGACAAGGAGGGTAACACAGCTCTTCACTACGCAGCAAAAAATGGCCATAGCAGTGTTGTTGAGACTCTTCTGGAAATATGGAAAGAAAATGAAATAGATGAGCCAAATGAGAGTGGGGCAACGCCGTTCTACCTGGCAGCTGGAGGAGGCCACGTGGCTTGTGCAGAATTACTATTGCATAAAGGAAGCAATATCAACACTACAACACATGATGGCTATGGTGCATTGCACATTGCAGCACAGAATGGTTTCACCTCCTTTGTCAGCTTTCTCTTATACAATGCAATTGAGTCCAACCCCGAGCCTAATGAGAGAAACAACCCCTTCCACCTCGCGCTCTTAAATAACCACATGGAAATCATTGACATTCTGCTAGAGAGAAAGTACGACATTAACGCCACAGAACGCAGGCAACAGAGCCCCCNTGCACTGGCAGCTGAATATAAGAACACGGAGCTGGTGGAAAGCTCCTCTAAGCGGAGTGATCTCCATCTTGATAGCAAAGAAACGCCTGGTACTGCGCTCGATACACTCCTACTG
  5   1   0       add Sto1      out                        CABG9567.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTGTTTCCCCCAGCAGACACCCGGGAGCACGATTTATCAAAGGCCAAGATGGAAAAATAAACTCAGTCTCATGATGTTGCTCTGCTTAGAACTGACCAGAGAAATGTCACACTAACCGCTCACTAACTTTACTGGCTGAGCACAGCAAGGTCACATGACATTCCTGttgtaagctctacggggcagggacctccatcctcttgtctcttttacttaacttattgccactgtaccttgtatttattgttatactttgtatttatctattattatctgtaaccccctgtttgtattaatttattctactgtacagcgctgcgtacataagtagcgctttattaataaagatatacatacatacatGCACTAAATTAATTCCTACTGACTGTCTAGTTGGCTGAAATGAGCAGCAGGTGGCGCTGTTGTTTCATTATATGAGCACTGCACAAACTCCTACTACCATGAAAACTAGAAAAAAAAATAATGTAAATTGCAAAAGTGCTCAGAAGAGCAATTTTACATTCATTTGTTTTGAAAGTTTACATTTCCTTTAAAGAGGGTTCTATTTAATGAACAACAATTTAGTGATTTTTATTCTATTTAACTGTAGAGGCAACAGAGCCCCCTGCACCTGGCAGCTGAATATAAGAACACGGAGCTGGTGGAAAAGCTCCTCATAGCGGGATGTGATCTCACAATCTCTGATAAGCAAAAGAAAACCGCCCTGGGTACTGCCGCTCGGAGTAACCACATCCTTATCGTGGATATGATTATCAAAGCAGAGAGATACTATGGGCTGATACAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)