Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Oct 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TEgg047e16.3                         38 END     1          12        2                (no blast hit)
     2   2.0    0Xt7.1-CABJ1033.3                            8 END     2          25       25                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 202.0    0Xt7.1-THdA052i22.5                         68 PI      79        887     1163                Kruppel-like factor 2 (lung) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012089263 Xt7.1-CAAN722.5 - 8 ESTs
                                                                       .-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CAAN722.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCTCCAGCTCTGGTGACTCGAAGGGAACCTGAGGAATTTAATGAGCTTCTGGACTTTGATTTTATCTTGTCCAATTCCCTTATCCACCAAGAGTCCATGACTGTGGGTTCTTCTTCTTCATCTTCGTCGGTCACTGCTTCCTCACCTCCACCTCCTGCCACACTTCCTGATACAATGTCTGCTCTCTCGTCTACCACTTGCAACTTTGTATACCAGGTACGTTGTCCCCAGGAATCATCAGGGGGCACCCTTATGTACAATGCAAGGGATCCTACTATGTCCAGTGCCACTTTCAACCTGGCGGATATAAATGATGTTTCACCTTCAGGGGGTTTTGTGGCTGAACTGATGAGACCTGACTTGGACCCAGTATTTATGCAACAACAGCCACAAGCTAGCTTGCAAGGTAAATTTGTTCTAAAGACAACTGTTAGCATGGGTGATTATGGCCAAACCATCAGTGTTAGGAAAAACAACTCTGGCATAGACAGTCCCTTGTCTTACACTACTCACCAGCTTCCTAGAGTGTGCCAAAAGATCAAGCAGGAACCTTCTTCATCTTGCACTTCAGCATGCCCAATGGATGGACAGGGCCAACAGTCACAAAGCATGCGTGAGTTTCAAGCAGGAAGGGGTCTACCAATTAGGACTAACCAATCTTTGTCCCCAGAAGAGCTGATGGGCAGAGACTGTCATTCTTCCTCTCAGACATTAAGTCATTCTTCATTGCCAATACCTCCAGCCTACCACACCTCTGCCAGTTTTTCCCACTTCACTTCAGATCAGCCGCAGACACAATTGCCTCCAACCCAGCTACAATATCAAGAGCTTTTGACAACTGGGGGTTGTATACCAGAGGAATCTAAACCCAAGCGGGGTCGAAAATCCTGGCCTAGGAAAAGGACTGCTACTCACACCTGTGAGTATGCAGGTTGCGGAAAGACCTATACCAAGAGTTCTCATTTAAAGGCTCACTTACGAACTCATACAGGTGAAAAGCCATACCACTGTGATTGGGAAGGATGTGGGTGGAAATTTGCTCGCTCAGATGAACTGACCCGGCACTACAGAAAACACACAGGTCACAGGCCTTTCCAGTGCCAGCGATGTGATCGAGCTTTCTCTAGGTCTGACCACCTTGCTCTGCACATGAAGAGGCACTTCTAAGTACTGCATGTCTTGTACTGCCATGAAATTCAGAGCTTGCGCTATATTTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCACTGTGGTTTCTATGTGCAATAATTTGTACTATTTCCAAATATGCCTTAAGCAGAACAAAATGTTTTTCTATATTTGACTTTACATAAAAAATATGTAATATAAAATTAAGCAAACGTCTATTTTGTATATTTGTAAACTATTAAAAATTTACTGTCACAGTTTTTTAATTTACATATTCAGTAAGTTTTGAATAAACGT
                                                  Xt7.1-CHK-1008237799                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCTCTGGTGACTCGAAGGGAACCTGAGGAATTTAATGAGCTTCTGGACTTTGATTTTATCTTGTCCAATTCCCTTATCCACCAAGAGTCCATGACTGTGGGTTCTTCTTCTTCATCTTCGTCGGTCACTGCTTCCTCACCTCCACCTCCTGCCACACTTCCTGATACAATGTCTGCTCTCTCGTCTACCACTTGCAACTTTGTATACCAGGTACGTTGTCCCCAGGAATCATCAGGGGGCACCCTTATGTACAATGCAAGGGATCCTACTATGTCCAGTGCCACTTTCAACCTGGCGGATATAAATGATGTTTCACCTTCAGGGGGTTTTGTGGCTGAACTGATGAGACCTGACTTGGACCCAGTATTTATGCAACAACAGCCACAAGCTAGCTTGCAAGGTAAATTTGTTCTAAAGACAACTGTTAGCATGGGTGATTATGGCCAAACCATCAGTGTTAGGAAAAACAACTCTGGCATAGACAGTCCCTTGTCTTACACTACTCACCAGCTTCCTAGAGTGTGCCAAAAGATCAAGCAGGAACCTTCTTCATCTTGCACTTCAGCATGCCCAATGGATGGACAGGGCCAACAGTCACAAAGCATGCGTGAGTTTCAAGCAGGAAGGGGTCTACCAATTAGGACTAACCAATCTTTGTCCCCAGAAGAGCTGATGGGCAGAGACTGTCATTCTTCCTCTCAGACATTAAGTCATTCTTCATTGCCAATACCTCCAGCCTACCACACCTCTGCCAGTTTTTCCCACTTCACTTCAGATCAGCCGCAGACACAATTGCCTCCAACCCAGCTACAATATCAAGAGCTTTTGACAACTGGGGGTTGTATACCAGAGGAATCTAAACCCAAGCGGGGTCGAAAATCCTGGCCTAGGAAAAGGACTGCTACTCACACCTGTGAGTATGCAGGTTGCGGAAAGACCTATACCAAGAGTTCTCATTTAAAGGCTCACTTACGAACTCATACAGGTGAAAAGCCATACCACTGTGATTGGGAAGGATGTGGGTGGAAATTTGCTCGCTCAGATGAACTGACCCGGCACTACAGAAAACACACAGGTCACAGGCCTTTCCAGTGCCAGCGATGTGATCGAGCTTTCTCTAGGTCTGACCACCTTGCTCTGCACATGAAGAGGCACTTCTAAGTACTGCATGTCTTGTACTGCCATGAAATTCAGAGCTTGCGCTATATTTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCACTGTGGTTTCTATGTGCAATAATTTGTACTATTTCCAAATATGCCTTAAGCAGAACAAAATGTTTTTCTATATTTGACTTTACATAAAAAATATGTAATATAAAATTAAGCAAACGTCTATTTTGTATATTTGTAAACTATTAAAAATTTACTGTCACAGTTTTTTAATTTACATATTCAGTAAGTTTTGAATAAACGTAGAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     3     1     3     1     3     1     3     2     4     2     4     3     4     3     4     3     4     3     4     3     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       PROTEIN --- Sc ---- 3e-016     NP_014756.1 probable transcription factor, asparagine-rich zinc-finger protein, suppressorof mutation in the nuclear gene for the core subunit of mitochondrial RNApolymerase; Azf1p [Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 4e-020     AAL83211.1 zinc finger transcription factor Egr/Krox [Branchiostoma floridae] --------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Cs ---- 9e-035     BAA36292.1 PEM-4 [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 3e-039     NP_497632.1 C2H2 type zinc finger containing protein [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 8e-041     NP_995811.1 CG33473-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 1e-049     XP_781601.1 PREDICTED: similar to Kruppel-like factor 2 (Lung kruppel-like factor) [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 9e-051     BAE06786.1 zinc finger protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dr ---- 7e-064     NP_571931.1 Kruppel-like factor 2a [Danio rerio] -------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xl ---- 6e-067     BAB69075.1 lung enriched kruppel like factor [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- ?? ---- 6e-067     NP_001080430.1 Kruppel-like factor 2 (lung) [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 6e-081     XP_001233584.1 PREDICTED: similar to EZF [Gallus gallus] --------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 4e-118     NP_004226.2 Kruppel-like factor 4 (gut); endothelial Kruppel-like zinc finger protein [Homosapiens] ----------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 8e-121     NP_034767.1 Kruppel-like factor 4 (gut) [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 0          CAJ81544.1 kruppel-like factor 4 (gut) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CAAN722.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAA------------------------------------------------------------------------------------TAG---------------------ATGTAA---------------------------------ATG------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------ATGTAA------------TAA------------------------------------------------------------------TAA---------------------------------------------------------TAA------------------------------------ATG------------------------------------------------------------------------------------TAG------------------TAA---------ATG---ATG------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAA---------------------TAA------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  0   1   1           Te3  FLt5                         CAAM641.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCTCCAGCTCTGGTGACTCGAAGGGAACCTGAGGAATTTAATGAGCTTCTGGACTTTGATTTTATCTTGTCCAATTCCCTTATCCACCAAGAGTCCATGACTGTGGGTTCTTCTTCTTCATCTTCGTCGGTCACTGCTTCCTCACCTCCACCTCCTGCCACACTTCCTGATACAATGTCTGCTCTCTCGTCTACCACTTGCAACTTTGTATACCAGGTACGTTGTCCCCAGGAATCATCAGGGGGCACCCTTATGTACAATGCAAGGGATCCTACTATGTCCAGTGCCACTTTCAACCTGGCGGATATAAATGATGTTTCACCTTCAGGGGGTTTTGTGGCTGAACTGATGAGACCTGACTTGGACCCAGTATTTATGCAACAACAGCCACAAGCTAGCTTGCAAGGTAAATTTGTTCTAAAGACAACTGTTAGCATGGGTGATTATGGCCAAACCATCAGTGTTAGGAAAAACAACTCTGGCATAGACAGTCCCTTGTCTTACACTACTCACCAGCTTCCTAGAGTGTGCCAAAAGATCAAGCAGGAACCTTCTTCATCTTGCACTTCAGCATGCCCAATGGATGGACAGGGCCAACAGTCACAAAGCATGCGTGAGTTTCAAGCAGGAAGGGGTCTACCAATTAGGACTAACCAATCTTTGTCCCCAGAAGAGCTGATGGGCAGAGACTGTCATTCTTCCTCTCAGACATTAAGTCATTCTTCATTGCCAATACCTCCAGCCTACCACACCTCTGCCAGTTTTTCCCACTTCACTTCAGATCAGCCGCAGACACAATTGCCTCCAACCCAGCTACAATATCAAGGTCAGTCTTATCTAAATATTTTTGAAGAGCCATTAAACTTGCAACTGTTGAAACAAGAAGTGATGTTGACTCCACCCTCTTCACCTCTAGAGCTTTTGACAACTGGGGGTTGTATACCAGAGGAATCTAAACCCAAGCGGGGTCGAAAATCCTGGCCTAGGAAAAGGACTGCTACTCACACCTGTGAGTATGCAGGTTGCGGAAAGACCTATACCAAGAGTTCTCATTTAAAGGCTCACTTACGAACTCATACAGGTGAAAAGCCATACCACTGTGATTGGGAAGGATGTGGGTGGAAATTTGCTCGCTCAGATGAACTGACCCGGCACTACAGAAAACACACAGGTCACAGGCCTTTCCAGTGCCAGCGATGTGATCGAGCTTTCTCTAGGTCTGACCACCTTGCTCTGCACATGAAGAGGCACTTCTAAGTACTGCATGTCTTGTACTGCCATGAAATTCAGAGCTTGCGCTATATTTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCACTGTGGTTTCTATGTGCAATAATTTGTACTATTTCCAAATATGCCTTAAGCAGAACAAAATGTTTTTCTATATTTGACTTTACATAAAAAATATGTAATATAAAATTAAGCAAACGTCTATTTTGTATATTTGTAAACTATTAAAAATTTACTGTCACAGTTTTTTAATTTACATATTCAGTAAGTTTTGAATAAACGTAGAAATATTTTATATGATGGAGGGAGACAGCTGTCCTTTACAAGGTCTTAACTTTCCTTTGCGATTTTTCTGTTTGCAGTTGTTACATTTTTTTTTCTCTTAGGTTAGATGCCGACCTCATATAGATAATATCACATGGGCAGTGTTGTTTTTGTGATAGACAAAATGAAACAGCAGAGCAGTCTGAGGCAAAGTATTTTAACAAGACTAGCATTTATTGCTCCCCAACCATAAAACTATAAGCTCCAACATCAAAAATGATTTCAGTAGAGACATCAATGACATGTTACTGTCAACCAACAAGCAATCCAGCCCTACTTTGGACAGTGACTGGAGAAGTGCCTCTATTTTTACAGTATAATTTAAATACAGAATTACTTTTACAGTCAGTAGTGACAAATTAACTCTATTTATAAAAGGAACCATTTTATAAAACCTTATTTTATCAATGTTACTCTTTGTCAGAACACTTGTGAATCATATACAACATACCATGTTTCTTTTATATTATTACAGGGAAGTTCCTTATCCTATACATAACTTGAGTGCAGCAGTATTGCATAGTGAACATTGACTATAGTCTACTTTTGTAAAAGGGTATGTGTGACCGACAAAAGGTTAACAGGAATTTTGGCATGATAGTAATGATTTCATTGCTTGACCGAACTATCTAACTATATATGTAACTTGCTGCAGTTACTGCTTATGTTGCATATTGTGTGATATGCCAGTTTTATGCTTTGTTTTATGAATACTGGAGATTGAAACAATCCATCAACAGGGCTTAAACACTTAGCAAAGAATTTCCAGGATAGTCAGTTTTAATTCAAATAATGGAAGTGCCAAAAACAAATGAGTGCCTTCACCTGTACAAATGACGTTTAGAGATTAGTATACAAATTATGTCACAATTTTTTTTCCAGTGTTAACATTTGTATATTGGTTTCCATAAAATCACAGTACAATCATGAATCACAGTTTTTAACTGCACCAGTTTATCCAACACTAACACAGCAATGATGTTTTAGAGCAAAATGTTCCAAACACTTTTCACAAAGGCCTCATATTTATCATAGGCAACAACCAGACCTTACCCATTTGAAATAGCACTGCCAATAATGCATTTAATTTTTGCAAATGCAATTAACATGTGATTAATTTTTATACATTATACTATCTTAGTCTGCCCTGTGATTTTTTTTTACCCACTGGAGCAGATATTACTGCCAAATGCAGAAAACATAGGATTGTGAGATAAGTAATGTATAATGGAACTGCTCTTGCCAAGATTGCTTGAAATATAAAAATGTGGGATTTTTCAATGTACCTGCCAGCATGTTTCACTAAATGTTCATTTTGTGCAAGTGCATACAATTTAAAAAAAAAATGAGTTTTAGTTACAAGCTTATGATCACAATATTGCTAAGCCACCACACCCACATTAATGCAGAGATGACCAATACTTATCGCAAGATAACAAGCTGCAAGGCAACAACCTATGAAAAGATGCAACCAGTGTTTAATAGGACCACCCTATGGGGTTTTGCTTAATATGGTATGGTGGCTTTGAAACATAATTATCATAAACTTGTAATGGACAACCCTTATATTTGAAAATGTATGCATTTGCTTGGGAAAAACAAAAGTTGTGAAACGGATTTATGTGGGTGAGACAAACATGTTATGGTGCAATTTGTCCTTATAGGTGCATAGTTAGATAACCTAAAAGTTGGGGGTAAATACCAGCCAGAATAACTCACCGTGCTTATTTAAGCAATAGATGGCATGAGAAACATCCATAAACTGTTATTGCCCATTGCTCTTTTTTCAAGAAACAAGTTTTTGCCATATAAACTGTTATTATGAATGTTATTTCCAGGGCCAACATTTAGGCTCACTAGTAAAAGCCATTCTGCCACTTGTTATTGAATGGAAAGTTAATTGCTGTAACTGAATGCAAACTACACTCCATATGTTTAAGCTAAAACTTTCATCTGCTGTTGTTTTGATTTTACTGCCATTTATATTTGTTAAAATTGATTTGTAAAGCTGCTATATTTCAGAAACACATCCAATAAATATTGAAAGCCAAAGATGCAAAAAAAAAAAAAAA
  5   1   2      skin Gas  FLq  in                   TGas106f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                TTCCATTTACTTGCAGTAAGCGGGCAGGGGCTGAACGGGGCGCTCGTACGAAAGGAGTCGTGAGCTCTATATGACAAGGAGCCTCCCATGACAAGTGCAGCTGGAGGGAATTCCCTAGCGCAGGTCTGTGTGACAGAGGCAGGGGACTCCGCCAGCTGCCCAGTGCCGTGAAACCCGCAAAGCTGCGCTGTGTCCCGCATAACTCTGCGCATGACGCGCTGCACTTGCTCCTCTTTATTCTCTGCGTCATCTCGTCAGGGGGGCAGCCACTCACCTGCCCTCCACTTGTCTCCGTACAATGCCAACGCTGAAATAAAAGAAAGAAGTGAAGGGAGCCCTTCTTTGGATTGTTTTGGTGACTTCTATACGCTCTTCGTTCGTGCGTCCTATGTGGATTTATCTGTTGCTACTGCGTCAAGCCCCGGACTGGCTCCGCTGACCCTGCCACATTGATGAGAGGTGGAGGGAAGACCCACCCCACATGAAGAGGCATTCTGTGCCTAACCAGTCTCGTGCTTATGATGGTTTGGAGATGGATTCTCCAGCTCTGGTGACTCGAAGGGAACCTGAGGAATTTAATGAGCTTCTGGACTTTGATTTTATCTTG
  5   1   2      skin Te3  FLt5 out                         CAAM641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCTCCAGCTCTGGTGACTCGAAGGGAACCTGAGGAATTTAATGAGCTTCTGGACTTTGATTTTATCTTGTCCAATTCCCTTATCCACCAAGAGTCCATGACTGTGGGTTCTTCTTCTTCATCTTCGTCGGTCACTGCTTCCTCACCTCCACCTCCTGCCACACTTCCTGATACAATGTCTGCTCTCTCGTCTACCACTTGCAACTTTGTATACCAGGTACGTTGTCCCCAGGAATCATCAGGGGGCACCCTTATGTACAATGCAAGGGATCCTACTATGTCCAGTGCCACTTTCAACCTGGCGGATATAAATGATGTTTCACCTTCAGGGGGTTTTGTGGCTGAACTGATGAGACCTGACTTGGACCCAGTATTTATGCAACAACAGCCACAAGCTAGCTTGCAAGGT
  5   1   2      skin Lun1      in                         CABD1793.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTCAACCTGGCGGATATAAATGATGTTTCACCTTCAGGGGGTTTTGTGGCTGAACTGATGAGACCTGACTTGGACCCAGTATTTATGCAACAACAGCCACAAGCTAGCTTGCAAGGTAAATTTGTTCTAAAGACAACTGTTAGCATGGGTGATTATGGCCAAACCATCAGTGTTAGGAAAAACAACTCTGGCATAGACAGTCCCTTGTCTTACACTACTCACCAGCTTCCTAGAGTGTGCCAAAAGATCAAGCAGGAACCTTCTTCATCTTGCACTTCAGCATGCCCAATGGATGGACAGGGCCAACAGTCACAAAGCATGCGTGAGTTTCAAGCAGGAAGGGGTCTACCAATTAGGACTAACCAATCTTTGTCCCCAGAAGAGCTGATGGGCAGAGACTGTCATTCTTCCTCTCAGACATTAAGTCATTCTTCATTGCCAATACCTCCAGCCTACCACACCTCTGCCAGTTTTTCCCACTTCACTTCAGATCAGCCGCAGACACAATTGCCTCCAACCCAGCTACAATATCAAGAGCTTTTGACAACTGGGGGTTGTATACCAGAGGAATCTAAACCCAAGCGGGGTCGAAAATCCTGGCCTAGGAAAAGGACTGCTACTCACACCTGTGAGTATGCAGGTTGCGGAAAGACCTATACCAAGAGTTCTCATTTAAAGGCTCACTTACGAACTCATACAGGTGAAAAGCCATACCACTGTGATTGGGAAGGATGTGGGTGGAAATTTGCTCGCTCAGATGAACTGACCCGGCACTA
  5   1   2       bld Te4       out                         CAAN722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACTCACACCTGTGAGTATGCAGGTTGCGGAAAGACCTATACCAAGAGTTCTCATTTAAAGGCTCACTTACGAACTCATACAGGTGAAAAGCCATACCACTGTGATTGGGAAGGATGTGGGTGGAAATTTGCTCGCTCAGATGAACTGACCCGGCACTACAGAAAACACACAGGTCACAGGCCTTTCCAGTGCCAGCGATGTGATCGAGCTTTCTCTAGGTCTGACCACCTTGCTCTGCACATGAAGAGGCACTTCTAAGTACTGCATGTCTTGTACTGCCATGAAATTCAGAGCTTGCGCTATATTTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTTCGATATACAAGTATGACCAAAGTCA
  3   1   2       bld Lun1      in                         CABD1793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCTGACCACCTTGCTCTGCACATGAAGAGGCACTTCTAAGTACTGCATGTCTTGTACTGCCATGAAATTCAGAGCTTGCGCTATATTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCACTGTGGTTTCTATGTGCAATAATTTGTACTATTTCCAAATATGCCTTAAGCAGAACAAAATGTTTTTCTATATTTGACTTTACATAAAAAATATGTAATATAAAATT
  3   1   2       bld Gas  FLq  in                    TGas106f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACATGAAGAGGCACTTCTAAGTACTGCATGTCTTGTACTGCCATGAAATTCAGAGCTTGCGCTATATTTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATGACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAATTTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTTATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCANCTGTGGTTTCTATGTGAATTAAATTTCTATTTTTAAAAAAAAAAAAAAAA
  3   1   2      seed Ski1      out                        CABJ5174.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAAATTCAGAGCTTGCGCTATATTTGGGCAAAAGGAATAACACAAGCACTACAAGTTATATAGCTGTATTATGGGACCACTGATATGTAACTTAACATACCATCTATCTTCAGAACTGGAAGAATGCAAACGTTAAAGTGGGATTTTGACTGGATCTTCAAGCATTCCGTGTTCATTTTTATAAAATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCACTGTGGTTTCTATGTGCAATAATTTGTACTATTTCCAAATATGCCTTAAGCAGAACAAAATGTTTTTCTATATTTGACTTTACATAAAAAATATGTAATATAAAATTAAGCAAACGTCTATTTTGTATATTTGTAAACTATTAAAAATTTACTGTCACAGTTTTTTAATTTACATATTCAGTAAGTTTTGAATAAACGTAGAAATATTT
  3   1   2       bld Egg       out                   TEgg018l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGACTTGAATCATCAGACTACAACATTGTTATAAGTGACTGGAATGGACATTTTGGTCAACCATTCAAGCTTAGAGGGCAATGCTACAAGTTACCAAATAAGTTTATGTAACTTTTGAGGAATTAATGCAATCCTTCAAGAGAAAAATCACAACTACAAACTTGTATTTTTTCATTCCTAATAATTTCTAACTAATCACAAAAACAGGAAAATTTTCAGGTACAGAATGTTGCTGGAAGGATTGAAATTAGTTAATGGTGCTTACAGACTGAAGCTTTTAATGGTACCAAAATGAAGCCAAAGTTCTCAAACTGCTGCATATCTGACAAGGAAATCTATTTTTGTCTTCCGATATACAAGTATGACCAAAGTCAGGGATAGAAACCTGATTTATTTTGTTAATATATATATATGTATATGCAGACAGTATGTGACGCACTGTGGTTTCTATGTGCAATAATTTGTACTATTTCCAAATATGCCTTAAGCAGAACAAAATGTTTTTCTATATTTGACTTTACATAAAAAATATGTAATATAAAATTAAGCAAACGTCTATTTTGTATATTTGTAAACTATTAAAAATTTACTGTCACAGTTTTTTAATTTACATATTCAGTAAGTTTTGAATAAACGTAGAAATATTTTATATGAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)