Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012089439 Xt7.1-CAAL9694.3 - 8 ESTs
                                                                       .......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAL9694.3                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCCTTTATCCCCGCAAACAAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTTTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGCAAGATAAACTAAAAGAAACTGAAGAAGCAATGGAAAAGATTATCTCCCGCTTGGGGCCCAACAGTGAAAGGACTGACAATGTGAGCTCCGATGAGGAAACAGATCTGCTCCAGCGCCTAAAGGAGATCACCAGGGTGATGAAGGAGGGTAAAATCTTGGATGGAATTTCTCCTGAAAAAGAAGCAGAAGAAGCTCCATACATGGAAGACTGGAACGGTTACCCAGAAGAGACCTATCCGGTTTATGACCCTTCGGACTGCAAACGAACCCAACAAACGATCCTCGTTGACTGCTCCGCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGGTTCTGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGACATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTCTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTCTGCGCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACT
                                                  Xt7.1-CHK-1008237840                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATCCCCGCAAACAAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTTTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGCAAGATAAACTAAAAGAAACTGAAGAAGCAATGGAAAAGATTATCTCCCGCTTGGGGCCCAACAGTGAAAGGACTGACAATGTGAGCTCCGATGAGGAAACAGATCTGCTCCAGCGCCTAAAGGAGATCACCAGGGTGATGAAGGAGGGTAAAATCTTGGATGGAATTTCTCCTGAAAAAGAAGCAGAAGAAGCTCCATACATGGAAGACTGGAACGGTTACCCAGAAGAGACCTATCCGGTTTATGACCCTTCGGACTGCAAACGAACCCAACAAACGATCCTCGTTGACTGCTCCGCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGGTTCTGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGACATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTCTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTCTGCGCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACTATTCCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                           2     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     5     5     4     4     4     4     4     4     4     4     4     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
                                               BLH ATG      22     629                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN      22      68                                                                                                                                                                                                                                                                                                                                                                                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Ce ---- 1e-013     NP_501299.1 putative protein, with a transmembrane domain,2 coiled coil domains, Resistance to Inhibitors of Cholinesterase RIC-3, DEgeneration Suppressor DES-5 (43.1 kD) (ric-3) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Dr ==== 4e-043     XP_697062.1 PREDICTED: similar to RIC3 protein [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 4e-091     NP_001033713.1 resistance to inhibitors of cholinesterase 3 homolog isoform a [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 2e-093     NP_078833.2 RIC3 protein [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 6e-096     XP_420991.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          AAI18844.1 Ric3 protein [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAL9694.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------TGA------------------ATG---------------------------TGA---------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------TAGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  0   1   1           BrSp FLt3                EC0CBA003BC09.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCGCATCTCCCTTTATCCCCGCAAACAAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTCTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Brn4 FL                         CAAL11363.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTTTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGCAAGATAAACTAAAAGAAACTGAAGAAGCAATGGAAAAGATTATCTCCCGCTTGGGGCCCAACAGTGAAAGGACTGACAATGTGAGCTCCGATGAGGAAACAGATCTGCTCCAGCGCCTAAAGGAGATCACCAGGGTGATGAAGGAGGGTAAAATCTTGGATGGAATTTCTCCTGAAAAAGAAGCAGAAGAAGCTCCATACATGGAAGACTGGAACGGTTACCCAGAAGAGACCTATCCGGTTTATGACCCTTCGGACTGCAAACGAACCCAACAAACGATCCTCGTTGACTGCTCCGCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGGTTCTGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGACATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTCTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTCTGCGCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACTATTCCTTGTCAAAAAAAAAAAAAAA
  5   1   2   14 skin Brn4 5g3  in                         CAAL9694.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................CTTCTCCCGTCTCTGTCGCATCTCCCTTTATCCCCGCAAACAAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCATTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTTTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGCAAGATAAACTAAAAGAAACTGAAGAAGCAATGGAAAAGATTATCTCCCGCTTGGGGCCCAACAGTGAAAGGACTGACAATGTGAGCTCCGATGAGGAAACAGATCTGCTCCAGCGCCTAAAGGAGATCACCAGGGTGATGAAGGAGGGTAAAATCTTGGATGGAATTTCTCCTGAAAAAGAAGCAGAAGAAGCTCCATACATGGAAGACTGGAACGGTTACCCAGAAGAGACCTATCCGGTTTATGACCCTTCGGACTGCAAACGAACCCAACAAACGATCCTCGTTGACTGCTCCGCGTTGAACCGACCATCGGCCGAACAGGTTGC
  3   1   2       bld BrSp FLt3 in                    EC0CBA003BC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGGTCGCATCTCCCTTTATCCCCGCAAACAAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTCTCATCCAAAGGGAAAAGCACCAAACAGGAACCCCCTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCCCTGACTATGAACTGAGCCCACTGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp FLt3 in                    EC0CBA003BC09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGTCGCATCTCCCTTTATCCCCGCAACAAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTCTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn4 FL   in                        CAAL11363.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATGGCTCTGTCCGCTGTCCAGAAGGTGGTTCTGTTCTCCTGCCTGGTCCTGTGCGTGTCCCTGCTGCTGCCCAGAGCCTACATAGCCAGGGGGAAGCCGGCAGCCCAGGAGGGAAATACTGGGCTCTTCCAGTCTTCCGGGCACCACCCGAAACCCACAGACGGCCGGCCCGGCGGCGCCCACTTCCCCAGATCCCATATGGCGGAAGCCATGTCGAAGGCGAAGGGGGGCACGGGCGGCGGAGGAGGAGGGGGCACCAGACCCAGCCTTGTGGGGCAGATTATACCAATCTATGGATTCGGGATTCTTCTCTATATCCTTTATATCTTATTTAAGCTTTCATCCAAAGGGAAAAGCACCAAACAGGAACCCACTACACAGCCTGTTGCCAACGGAAACCTGAAGAGGAAAATCACTGACTATGAACTGAGCCAACTGCAAGATAAACTAAAAGAAACTGAAGAAGCAATGGAAAAGATTATCTCCCGCTTGGGGCCCAACAGTGAAAGGACTGACAATGTGAGCTCCGATGAGGAAACAGATCTGCTCCAGCGCCTAAAGGAGATCACCAGGGTGATGAAGGAGGGTAAAATCTTGGATGGAATTTCTCCTGAAAAAGAAGCAGAAGAAGCTCCATACATGGAAGACTGGAACGGTTACCCAGAAGAGACCTATCCGGTTTATGACCCTTCGGACTGCAAACGAACCCAACAAACGATCCTCGTTGACTGCTCCGCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGGTTCTGGGAATTTGGCCAAGGACCTGACTATAAGACAG
  3   1   2       bld Brn4 FL   in                        CAAL11363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGTTCTGGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGACATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTCTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTCTGCGCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACTATTCCTTGTC
  3   1   2      seed Brn4 5g3  in                         CAAL9694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGGTTCTGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGACATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTCTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTCTGCGCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACTATTCCTTGTC
  5   1   2       bld Tad5      in                         XZT25355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGTTGAACCGACCATCGGCCGAACAGGTTGCAGAGCAGATGGGCTTTGATGAGGAGGATGATCAGGAGAATGGTTCTGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGACATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTCTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTCTGCGCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACTATTCCTTGTCAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT25355.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATGGTTCTGGGAATTTGGCCAAGGAACCTGACTATAAGGACAGTGTGGGGGGTGACCAACAAGCCCAAGGGACCATCTCAGCCCAAGGCAAAGTTGTTGGAACCGGGGAGGCCATTGAAGAAGATGAAGATGAGGACGAGGATCCAGAAGTCATAGCTGAAAACGCTGGGTTCATATCAGACAGCTGCAACGAAGAAGAGGATCCCAAGGAATCTTTTATGGACTTAGGAAATGAAAAGGGACCATTGGGGGCCACGCTGGGGTCCAATCGAGATGAAACTGGTACTTTACGGAAAAGGAACACAAAGGGCATTGAGTACTGATTGCTACATGGTTCCTTCATGGGAAAAGGTCCGAGATGCCCAGGTTGGTGATACTTTGAGAACATCTACCCTCAGCCTGACTGCGGTGGTCCAACTGCCCATGTTTTTGGCTCTTACGAAGCATGCCCCTCCCACGCTGAAGATGTGGGAGGGAAATAACGATTCAATGACAGGACCCACGGCTATGGGAATGGGCCAAGCTTTGCCCCATCTTGGAGAAGGCAACCCCAACCTGTGGATTGGTCAAGGAATGGTTTGGATGAACTGGGGAAGGGGCACCACGTCACTATTCATATTTAATTGGATGTATATAATATTATCAGGGTCGATAATGGGAACAATTGTTACTCGGGGGACACTGGCACCCAACTAGTAAAGTAGTAACTATTCCTTGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)