Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 0%

 1012089502 Xt7.1-CABD468.3 - 5 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CABD468.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCTTCTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGG
                                                  Xt7.1-CHK-1008243095                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGGTTATCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bb ---- 5e-007     BAD97679.1 fibrillar collagen [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-007     NP_723044.1 Collagen type IV CG4145-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 4e-008     NP_001023322.1 M199.5 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bf ---- 2e-009     ABG36939.1 fibril collagen [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-012     XP_780567.1 PREDICTED: similar to Complement C1q tumor necrosis factor-related protein 4 precursor isoform 1 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 7e-017     AAH75339.1 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 6e-018     AAI23272.1 MGC154542 protein [Xenopus laevis] -=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-074     NP_112230.1 C1q and tumor necrosis factor related protein 1 isoform 1 [Homo sapiens] -------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - ?? ---- 2e-075     XP_693502.1 PREDICTED: similar to C1q and tumor necrosis factor related protein 6 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 2e-077     NP_001017875.1 hypothetical protein LOC550573 [Danio rerio] -----------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 5e-080     NP_064343.1 C1q and tumor necrosis factor related protein 1 [Mus musculus] -----------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ==== 7e-092     XP_425240.1 PREDICTED: similar to C1qtnf1 protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CABD468.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------ATG------------------------------------ATG------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------TGAATG------------------------------------TAA---------------------------TGA---------------ATG------------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Lun1 FL   in                          CABD468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAATCCTTAGCGGACAGTTTCTAATTTGCTAGAAAACCCAGAGACGTGGGGCCAACGAGGCAGAGGGAAGAGAGCAGCCAGCGAGTGAGTACGAGTTAAGCCCAGGAGATCAGTGATGGATTTCCCCACGTTCATCTTCTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTTCACGGATACCTGATACGACCAGCTACAGA
  5   1   2       bld Hrt1      in                        CAAQ10219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCTTCTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCCATACAAAGACTTTGCTTTGCTACNNTATT
  3   1   2      seed Lun1 FL   in                          CABD468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCCACAAATAGATATGACCATCTNGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGGTTATCTG
  3   1   2       bld Hrt1      in                        CAAQ10219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGGTTATCTG
  5   1   2       bld AbdN                               IMAGE:7004232                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACAAGCAGGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTAAANAAAAAAAAAAAAAAAN

In case of problems mail me! (