Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012089502 Xt7.1-CABD468.3 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CABD468.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCTTCTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGG
                                                  Xt7.1-CHK-1008243095                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGGTTATCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bb ---- 5e-007     BAD97679.1 fibrillar collagen [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-007     NP_723044.1 Collagen type IV CG4145-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 4e-008     NP_001023322.1 M199.5 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bf ---- 2e-009     ABG36939.1 fibril collagen [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-012     XP_780567.1 PREDICTED: similar to Complement C1q tumor necrosis factor-related protein 4 precursor isoform 1 [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xt ---- 7e-017     AAH75339.1 Collagen, type VII, alpha 1 (epidermolysis bullosa, dystrophic, dominant and recessive) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 6e-018     AAI23272.1 MGC154542 protein [Xenopus laevis] -=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Hs ---- 2e-074     NP_112230.1 C1q and tumor necrosis factor related protein 1 isoform 1 [Homo sapiens] -------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - ?? ---- 2e-075     XP_693502.1 PREDICTED: similar to C1q and tumor necrosis factor related protein 6 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 2e-077     NP_001017875.1 hypothetical protein LOC550573 [Danio rerio] -----------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Mm ---- 5e-080     NP_064343.1 C1q and tumor necrosis factor related protein 1 [Mus musculus] -----------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ==== 7e-092     XP_425240.1 PREDICTED: similar to C1qtnf1 protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CABD468.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------ATG------------------------------------ATG------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------TGAATG------------------------------------TAA---------------------------TGA---------------ATG------------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Lun1 FL   in                          CABD468.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAATCCTTAGCGGACAGTTTCTAATTTGCTAGAAAACCCAGAGACGTGGGGCCAACGAGGCAGAGGGAAGAGAGCAGCCAGCGAGTGAGTACGAGTTAAGCCCAGGAGATCAGTGATGGATTTCCCCACGTTCATCTTCTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTTCACGGATACCTGATACGACCAGCTACAGA
  5   1   2       bld Hrt1      in                        CAAQ10219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCTTCTTGTCCTCCCTTATTTCTGTTGAAGTCTTAGCCCAAAGGACCTTCCTGTGGCAGGAGGTAGGAAGCCCTTCGTGCGTACGATGCTGTGATGATTCAGAGAAACCTGTTTCCAACCCAACGAAGAGCAGGGTGAAGCAATATATCCTCTACCCTGCGCCAAAATTCCAGCCACAAATAGATATGACCATCTTGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCCATACAAAGACTTTGCTTTGCTACNNTATT
  3   1   2      seed Lun1 FL   in                          CABD468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCCACAAATAGATATGACCATCTNGAAAGGTGACAAAGGTGAGAATGGTGAAGAAGGACAAGCAGGGAGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGGTTATCTG
  3   1   2       bld Hrt1      in                        CAAQ10219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGTCAGGAAGAGATGGTGAACCTGGACCACCGGGAGCTTTAGGGGAAAAAGGCCAAAAGGGTCAAAGAGGTCCATCAGGAAATTCCTGCAAGAACCAATATGCTGCGTTTTCTGTGGCTCGTCGGAAATCCCTTCACAGCACCGACTATTTCCAGCCTGTGATATTTGACACAGTGTTTGTAAACTTGTACGAGCACTTTAATATGTTCTCAGGGATCTTTTTCTGCTACATTCCTGGGATTTACTTCTTTAACCTGAACGTTCACACATGGAACCTCAAGGAGACCTACCTGCACATCATCAAGAACAGCCAGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTATTCTTGTCTACTAAGGCTAGGTAATTTATTACCATCCCATATGTTTAAAAGTATAATAAAGGAAACTCAGGTTATCTG
  5   1   2       bld AbdN                               IMAGE:7004232                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGACAAGCAGGGAGGTGGCCATGTTGTACGCTCAGCCCAGTGACCGTAGCATTATGCAGAGCCAGAGCATCATGCTTGACTTGCAAGAGAAAGACGAGGTGTGGGTGCGAATGTTTAAACGAGAAAGAGAGAACGCCATTTATAGCGACGACACTGACGTCTACATTATCTTCAACGGATACCTGATACGACCAGCTACAGAATAGACTTTCTATGGAAAATGTAGGCTATGGTCTAACAGCGTTACTATTCCATTACAAAGACTTTGCTTTGCTACTTATTTGTATTCATACATATGAATGGGAGCTACCATCTTTCTTGCTTGGCAGAGGCATTCTTAAACGAGGGGAAAGTGCAGTATCTGTTTCTGATCACTAAAGGCACTTATGGTAAANAAAAAAAAAAAAAAAN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)