Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA016i02.3                          4 END     4         100      100                LOC445827 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 290.0    0Xt7.1-XZT65774.5                           55 PI      77        390      862                LOC445827 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012089618 Xt7.1-CBWN12266.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CBWN12266.5 CTTGCGCCATCTTTATTTTGGGCACATTCCCTGAAATACACTAGAGAACGTGAAACTACGATGGTGAAGGTGCGGTTCTTCACGCTAGTGTTACAGCTGGGATCTTGGAATTTGGATTGCACTAAAGAGTAGAACACAAATGTGAATCTGAGCATGTGGCTGTTATTTCAATCCCATAGTCGCATGAATCCGAAATTTGTTATTGGGATTTAGTAATAGAAGTCATGGGATCACTAAGATCATTGTCGTCATCATGTTGGACACTGCTGGTTGGCAGGAAGATTTTGGCCTGTGTGGCATCTGTTCCATATAGATCATATCACCCCAGTGATCAGCCCACGATAGATGCTGTTGAAGATGGAATTGCCCAGCCAGAGGTGCAGAAACATTTTGTCCTTAAAACTCCAAAGGGCACCCATGATGTTCATCCCAAACAAATGGCGATCCGGGAGAGAGTTCTCAGCACTGTTGTGAATTGCTTTAAGCGTCATGGAGCTGAGACAATTGACACTCCTGTCTTTGAACTGAAAGAAACTCTGACTGGAAAATATGGAGAAGATTCTAAACTGATCTATGATCTGAAGGACCAGGGAGGAGAGCTGCTGTCATTGCGCTATGACCTGACTGTGCCATTTGCTCGCTTCCTGGCCATGAACAAGATCACCAATATGAAGCGCTATCACATTGGCAAGGTTTATCGGCGGGACAAGCCGGCCAGAGGCCGCTACAGAGAATTCTATCAGTGTGACTTTGACATTGCTGGACACCATGACCCCATGATTCCTGATGCCGAGTGCTTGAAAATTCTGCATGAGATACTCACAGAACTGGAGCTGGGAAACTTTCGCATCAAGGTGAATGATCGAAGGCTTCTCATTGGAATTCTTA
                                                  Xt7.1-CHK-1008246210       CCATCTTTATTTTGGGCACATTCCCTGAAATACACTAGAGAACGTGAAACTACGxxxxxxxAxxxxCGGTTCTTCACGCTAGTGTTACAGCTGGGATCTTGGAATTTGGATTGCACTAAAGAGTAGAACACAAATGTGAATCTGAGCATGTGGCTGTTATTTCAATCCCATAGTCGCATGAATCCGAAATTTGTTATTGGGATTTAGTAATAGAAGTCATGGGATCACTAAGATCATTGTCGTCATCATGTTGGACACTGCTGGTTGGCAGGAAGATTTTGGCCTGTGTGGCATCTGTTCCATATAGATCATATCACCCCAGTGATCAGCCCACGATAGATGCTGTTGAAGATGGAATTGCCCAGCCAGAGGTGCAGAAACATTTTGTCCTTAAAACTCCAAAGGGCACCCATGATGTTCATCCCAAACAAATGGCGATCCGGGAGAGAGTTCTCAGCACTGTTGTGAATTGCTTTAAGCGTCATGGAGCTGAGACAATTGACACTCCTGTCTTTGAACTGAAAGAAACTCTGACTGGAAAATATGGAGAAGATTCTAAACTGATCTATGATCTGAAGGACCAGGGAGGAGAGCTGCTGTCATTGCGCTATGACCTGACTGTGCCATTTGCTCGCTTCCTGGCCATGAACAAGATCACCAATATGAAGCGCTATCACATTGGCAAGGTTTATCGGCGGGACAAGCCGGCCAGAGGCCGCTACAGAGAATTCTATCAGTGTGACTTTGACATTGCTGGACACCATGACCCCATGATTCCTGATGCCGAGTGCTTGAAAATTCTGCATGAGATACTCACAGAACTGGAGCTGGGAAACTTTCGCATCAAGGTGAATGATCGAAGGCTTCTCATTGGAATTCTTACAGTCT
                                                      consensus depths      1     1     1     1     1     1     1     1     1     2     2     4     2     4     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     224     369 
                                               BLH MIN     341      68 
                                               BLH MPR     206      68 
                                               BLH OVR     224     847 
                                               CDS MIN     224      68 
                                               ORF LNG     224      41 
                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 7e-059     NP_015358.1 Nuclear gene that specifies two messages for cytoplasmic and mitochondrialforms; Hts1p [Saccharomyces cerevisiae] -----=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 1e-061     NP_001023373.1 Histidyl tRNA Synthetase family member (hrs-1) [Caenorhabditis elegans] --------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 4e-068     NP_728180.1 CG6335-PA [Drosophila melanogaster] --------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 4e-071     XP_787474.2 PREDICTED: similar to histidyl-tRNA synthetase, partial [Strongylocentrotus purpuratus] ----------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                             PROTEIN --- Hs ---- 1e-075     NP_002100.2 histidyl-tRNA synthetase; histidine-tRNA ligase; HisRS; histidine translase[Homo sapiens] -----------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 3e-077     NP_032240.2 histidyl-tRNA synthetase; histidyl tRNA synthetase [Mus musculus] -----------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 5e-078     NP_001006144.1 similar to Hars protein [Gallus gallus] ----------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN --- Dr ---- 5e-078     NP_001004586.1 zgc:92215 [Danio rerio] -----------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 6e-080     AAH76748.1 LOC445827 protein [Xenopus laevis] ----------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CBWN12266.5                                          TAG------TGA---------------------------------------------------------------------TAA---------------------------------------------------TAG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ...
  5   1   2   10  bld Te1  5g3  out                       CBWN11026.b1 CTTGCGCCATCTTTATTTTGGGCACATTCCCTGAAATACACTAGAGAACGTGAAACTACGTGAAATCATTGCCGGTTCTTCACGCTAGTGTTACAGCTGGGATCTTGGAATTTGGATTGCACTAAAGAGTAGAACACAAATGTGAATCTGAGCATGTGGCTGTTATTTCAATCCCATAGTCGCATGAATCCGAAATTTGTTATTGGGATTTAGTAATAGAAGTCATGGGATCACTAAGATCATTGTCGTCATCATGTTGGACACTGCTGGTTGGCAGGAAGATTTTGGCCTGTGTGGCATCTGTTCCATATAGATCATATCACCCCAGTGATCAGCCCACGATAGATGCTGTTGAAGATGGAATTGCCCAGCCAGAGGTGCAGAAACATTTTGTCCTTAAAACTCCAAAGGGCACCCATGATGTTCATCCCAAACAAATGGCGATCCGGGAGAGAGTTCTCAGCACTGTTGTGAATTGCTTTAAGCGTCATGGAGCTGAGACAATTGACACTCCTGTCTTTGAACTGAAAGAAACTCTGACTGGAAAATATGGAGAAGATTCTAAACTGATCTATGATCTGAAGGACCAGGGAGGAGAGCTGCTGTCATTGCGCTATGACCTGACTGTGCCATTTGCTCGCTTCCTGGCCATGAACAAGATCACCAATATGAAGCGCTATCACATTGGCAAGGTTTATCGGCGGGACAAGCCGGCC
  5   1   2       bld TpA  5g3  out                  TTpA016i02.p1kSP6                                                AGAACGTGAAACTACAGATCATTGCCGGTTCTTCACGCTAGTGTTACAGCTGGGATCTTGGAATTTGGATTGCACTAAAGAGTAGAACACAAATGTGAATCTGAGCATGTGGCTGTTATTTCAATCCCATAGTCGCATGAATCCGAAATTTGTTATTGGGATTTAGTAATAGAAGTCATGGGATCACTAAGATCATTGTCGTCATCATGTTGGACACTGCTGGTTGGCAGGAAGATTTTGGCCTGTGTGGCATCTGTTCCATATAGATCATATCACCCCAGTGATCAGCCCACAATAGATGCTGTTGAAGATGGAATTGCCCAGCCAGAGGTGCAGAAACATTTTGTCCTTAAAACTCCAAAGGGCACCCATGATGTTCATCCCAAACAAATGGCGATCCGGGAGAGAGTTCTCAGCACTGTTGTGAATTGCTTTAAGCGTCATGGAGCTGAGACAATTGACACTCCTGTCTTTGAACTGAAAGAAACTCTGACTGGAAAATATGGAGAAGATTCTAAACTGATCTATGATCTGAAGGACCAGGGAGGAGAGCTGCTGTCATTGCGCTATGACCTGACTGTGCCATTTGCTCGCTTCCTGGCCATGAACAAGATCACCAATATGAAGCGCTATCACATTGGCAAGGTTTATCGGCGGGACAAGCCGGCCAGAGGCCGCTACAGAGAATTCTATCAGTGTGACTTTGACATTGCTGGACACCATGACCCCATGATTCCTGATGCCGAGTGCTTGAAAATTCTGCATGAGATACTCACAGAACTGGAGCTGGGAAACTTTCGCATCAAGGTGAATGATCGAAGGCTTCTCATTGGAATTCTTACAGTCTGT
  5   1   2   10  bld Te1  5g3  out                        CBWN5616.b1 ..................................................CATTGAATGGATGGTGAAGGTGACATGTGCATTTAAACATTTACAGCTGGGATCTTGGAATTTGGATTGCACTAAAGAGTAGAACACAAATGTGAATCTGAGCATGTGGCTGTTATTTCAATCCCATAGTCGCATGAATCCGAAATTTGTTATTGGGATTTAGTAATAGAAGTCATGGGATCACTAAGATCATTGTCGTCATCATGTTGGACACTGCTGGTTGGCAGGAAGATTTTGGCCTGTGTGGCATCTGTTCCATATAGATCATATCACCCCAGTGATCAGCCCACGATAGATGCTGTTGAAGATGGAATTGCCCAGCCAGAGGTGCAGAAACATTTTGTCCTTAAAACTCCAAAGGGCACCCATGATGTTCATCCCAAACAAATGGCGATCCGGGAGAGAGTTCTCAGCACTGTTGTGAATTGCTTTAAGCGTCATGGAGCTGAGACAATTGACACTCCTGTCTTTGAACTGAAAGAAACTCTGACTGGAAAATATGGAGAAGATTCTAAACTGATCTATGATCTGAAGGACCAGGGAGGAGAGCTGCTGTCATTGCGCTATGACCTGACTGTGCCATTTGCTCGCTTCCTGGCCATGAACAAGATCACCAATATGAAGCGCTATCACATTGGCAAGGTTTATCGGCGGGACAAGCCGGC
  5   1   2   10 seed Te1  5g3  out                       CBWN12266.b1 .........................................................TGGATGGTGAAGGTGACATGTGCATTTAAACATTTACAGCTGGGATCTTGGAATTTGGATTGCACTAAAGAGTAGAACACAAATGTGAATCTGAGCATGTGGCTGTTATTTCAATCCCATAGTCGCATGAATCCGAAATTTGTTATTGGGATTTAGTAATAGAAGTCATGGGATCACTAAGATCATTGTCGTCATCATGTTGGACACTGCTGGTTGGCAGGAAGATTTTGGCCTGTGTGGCATCTGTTCCATATAGATCATATCACCCCAGTGATCAGCCCACAATAGATGCTGTTGAAGATGGAATTGCCCAGCCAGAGGTGCAGAAACATTTTGTCCTTAAAACTCCAAAGGGCACCCATGATGTTCATCCCAAACAAATGGCGATCCGGGAGAGAGTTCTCAGCACTGTTGTGAATTGCTTTAAGCGTCATGGAGCTGAGACAATTGACACTCCTGTCTTTGAACTGAAAGAAACTCTGACTGGAAAATATGGAGAAGATTCTAAACTGATCTATGATCTGAAGGACCAGGGAGGAGAGCTGCTGTCATTGCGCTATGACCTGACTGTGCCATTTGCTCGCTTCCTGGCCATGAACAAGATCACCAATATGAAGCGCTATCACATTGGCAAGGTTTATCGGCGGGACAAGCCGGCCAGAGGCCGCTACAGAGAATTCTATCAGTGTGACTTTGACATTGCTGGACACCATGACCCCATGATTCCTGATGCCGAGTGCTTGAAAATTCTGCATGAGATACTCACAGAACT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)