Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG26155.3                           33 END     2          40        6                (no blast hit)
     2   2.0    0Xt7.1-CAAN4970.5                            8 END     2          40       28                LOC431863 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012089738 Xt7.1-CAAN4970.3 - 5 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAN4970.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGGTACGGCTGACCTACTGGTAGAAGCTTTGGGTGCCAAGATTGTGAATAGCAGAGATGCCAAAGGGAGGACTCCTCTTCATGCTGCAGCATTTGCTGACAATGTGAACGGTTTACAACTACTCTTGCACCACCAGGCTGAGGTCAATGCCACAGACCTCTCTGGTCGGACACCTCTGATGATGTCAGCAGAAAATGGAAGGACTGCAGCAGTTGAGTTCCTGCTGTTTCACATGAAGGCGGATTTAACTGTGATGGATATCAACAAGAACACTGCGCTTCACCTAGCCTGCAGCAAGGGACATGAAAAGTGTGCTTTGCTGCTTCTAGGGGAGACCCAGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGCAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGCCATGGATGGCTGCTACTCCGAGTAGCTTCTTTTGCCCTCTGGGTGATGCATCCTTACATTTAATTTATTTAGGATAATTTTAGGGCACTTTTTTAAAGGAGAATAA
                                                  Xt7.1-CHK-1008243789                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGGCTGACCTACTGGTAGAAGCTTTGGGTGCCAAGATTGTGAATAGCAGAGATGCCAAAGGGAGGACTCCTCTTCATGCTGCAGCATTTGCTGACAATGTGAACGGTTTACAACTACTCTTGCACCACCAGGCTGAGGTCAATGCCACAGACCTCTCTGGTCGGACACCTCTGATGATGTCAGCAGAAAATGGAAGGACTGCAGCAGTTGAGTTCCTGCTGTTTCACATGAAGGCGGATTTAACTGTGATGGATATCAACAAGAACACTGCGCTTCACCTAGCCTGCAGCAAGGGACATGAAAAGTGTGCTTTGCTGCTTCTAGGGGAGACCCAGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGCAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGCCATGGATGGCTGCTACTCCGAGTAGCTTCTTTTGCCCTCTGGGTGATGCATCCTTACATTTAATTTATTTAGGATAATTTTAGGGCACTTTTTTAAAGGAGAATAAGACATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4
                                                                       ...PROTEIN --- Ci ---- 8e-007     FAA00217.1 TPA: zinc finger protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Bf ---- 3e-008     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN --- Ce ---- 2e-013     NP_500898.1 UNCoordinated family member (unc-44) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-015     NP_523483.1 no mechanoreceptor potential C CG11020-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Xl ---- 2e-015     CAE09056.1 putative transient receptor potential channel [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-018     XP_780972.1 PREDICTED: similar to ankyrin repeat domain 27 (VPS9 domain), partial [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - ?? ---- 7e-065     XP_693039.1 PREDICTED: similar to Ankyrin repeat domain protein 28, partial [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-066     NP_056014.2 ankyrin repeat domain 28 [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 5e-069     CAJ82018.1 ankyrin repeat domain 28 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-072     NP_001018164.1 hypothetical protein LOC553206 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 4e-107     NP_766378.1 RIKEN cDNA G431002C21 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 4e-112     NP_001012957.1 similar to RIKEN cDNA G431002C21 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAN4970.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGATG------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAG------------------TGA---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld Te3       out                        CAAM2554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATTATAATGCATATACTCCCATGCACTGGGCTGCTTACAATGGGCACGAAGATTGTTTGGAACTGTTACTTGAACACAACCCATTTGCATACCTCGAAGGAAACCCTTTTACCCCTTTGCACTGTGCAGTAATTAACAGCCAAGATGGTACGGCTGACCTACTGGTAGAAGCTTTGGGTGCCAAGATTGTGAATAGCAGAGATGCCAAAGGGAGGACTCCTCTTCATGCTGCAGCATTTGCTGACAATGTGAACGGTTTACAACTACTCTTGCACCACCAGGCTGAGGTCAATGCCACAGACCTCTCTGGTCGGACACCTCTGATGATGTCAGCAGAAAATGGAAGGACTGCAGCAGTTGAGTTCCTGCTGTTTCACATGAAGGCGGATTTAACTGTGATGGATATCAACAAGAACACTGCGCTTCACCTAGCCTGCAGCAAGGGACATGAAAAGTGTGCTTTGCTGCTTCTAGGGGAGACCCGGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGGCATGGATGGCTGCTACTCTGAGTAGCTTCTTTTGCC
  3   1   2       bld Te4  5g3  out                        CAAN4970.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTACCCCCTTTGCACTGTGCAGTAATTACAGCCCAAGATGGTACGGCTGACCTACTGGTAGAAGCTTTGGGTGCCAAGATTGTGAATAGCAGAGATGCCAAAGGGAGGACTCCTCTTCATGCTGCAGCATTTGCTGACAATGTGAACGGTTTACAACTACTCTTGCACCACCAGGCTGAGGTCAATGCCACAGACCTCTCTGGTCGGACACCTCTGATGATGTCAGCAGAAAATGGAAGGACTGCAGCAGTTGAGTTCCTGCTGTTTCACATGAAGGCGGATTTAACTGTGATGGATATCAACAAGAACACTGCGCTTCACCTAGCCTGCAGCAAGGGACATGAAAAGTGTGCTTTGCTGCTTCTAGGGGAGACCCAGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGCAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGCCATGGATGGCTGCTACTCCGAGTAGCTTCTTTTGCCCTCTGGGTGATGCATCCTTACATTTAATTTATTTAGGATAATTTTAGGGCACTTTTTTAAAGGAGAATAAGACACAAC
  5   1   2      seed Brn3      out                        CAAK5887.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGCTGACCTACTGGTAGAAGCTTTGGGTGCCAAGATTGTGAATAGCAGAGATGCCAAAGGGAGGACTCCTCTTCATGCTGCAGCATTTGCTGACAATGTGAACGGTTTACAACTACTCTTGCACCACCAGGCTGAGGTCAATGCCACAGACCTCTCTGGTCGGACACCTCTGATGATGTCAGCAGAAAATGGAAGGACTGCAGCAGTTGAGTTCCTGCTGTTTCACATGAAGGCGGATTTAACTGTGATGGATATCAACAAGAACACTGCGCTTCACCTAGCCTGCAGCAAGGGACATGAAAAGTGTGCTTTGCTGCTTCTAGGGGAGACCCAGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGCAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGCCATGGATGGCTGCTACTCCGAGTAGCTTCTTTTGCCCTCTGGGTGATGCATCCTTACATTTAATTTATTTAGGATAATTTTAGGGCACTTTTTTAAAGGAGAATAAGACATCACATACAGTGGTGTTGAGCTGCTTACTAGGCTTTCCTCCCATTAACCTGCTCTCTTGAGCTGCCCTGGCTTGCACTGAAAGCTATGTAGTATTGTACCTTACTTGCGTATGGG
  3   1   2       bld Te4  FL   out                        CAAN8718.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAGATTGTGAATAGCAGAGATGCCAAAGGGAGGACTCCTCTTCATGCTGCAGCATTTGCTGACAATGTGAACGGTTTACAACTACTCTTGCACCACCAGGCTGAGGTCAATGCCACAGACCTCTCTGGTCGGACACCTCTGATGATGTCAGCAGAAAATGGAAGGACTGCAGCAGTTGAGTTCCTGCTGTTTCACATGAAGGCGGATTTAACTGTGATGGATATCAACAAGAACACTGCGCTTCACCTAGCCTGCAGCAAGGGACATGAAAAGTGTGCTTTGCTGCTTCTAGGGGAGACCCAGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGCCATGGATGGCTGCTACTCCGAGTAGCTTCTTTTGCCCTCTGGGTGATGCATCCTTACATTTAATTTATTTAGGATAATTTTAGGGCACTTTTTTAAAGGAGAATAAGACACAAC
  5   1   2       bld Egg                            TEgg118g23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCTTCTAGGGGAGACCCAGGACCTTGGCCTTATCAATGCAACAAACAGCATGCTGCAGATGCCTCTTCACATTGCTGCTCGCAATGGGCTGGCATCGGTCGTCCAAGCTTTGCTTACAAGAGGGGCCACTGTGTTGGCTGTGGATGAAGAAGCAGGTCACACCCCAGCCTTGGCCTGTGCACCGAACAAGGACGTAGCGGACTGCTTGGCACTTATCCTATCCACCATGAAGCCTTTCCCACCAAAAGACGCCATCCTTCCCTTCAGTTTCAACCTTCTGAAAAACTGCAGCATCGCTGCCAAGACTGCCCTCCCTAATGGTGGCAGCTGCCCCTACACAAAGGATCGTCATGGTTCTATTGCCATGGATGGCTGCTACTCCGAGTAGCTTCTTTTGCCCTCTGGGTGATGCATCCTTACATTTAATTTATTTAGGATAATTTTAGGGCACTTTTTTAAAGGAGAATAAAATTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)