Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:7003749.5                       4 END     1          11       33                MGC88978 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012089857 Xt7.1-XZT32866.5 - 9 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT32866.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACATTTTCCTTAGTCATGGTTCACTGCTAGCCAAGAGTTGTCAATCTGCAATGCTATTGGCACATCATGATTCAGAGATTTCGTCAAGGGCTTTCCAATATGGAAAACATATGTCTATCAGTTACAAGCTAAGTTCAGACCTCCAGCCATTCATCAATAGAAAATACAGTGATTCGTTGTTTAGCCTGAATTCTGCTCCAGTGGTTCTTCACCAGGAATTTATTGGAACAGAAGCCTGGATGGAGCAGATCAAAGAGGCTCAACTGAAAGACAACTTGATTGACCGCATAAAGTTGCAAAAGGCAATCAAGGCTGGCAAAGGTGTGACTTCTGCTACTGACCTGTGTTGTTACCATGGAGACAAAGCTCTGGAGGCCCTGCAGTGTTTTCCTGCCTCTGAGGCCAGATCTGCCTTGGAAAACATTATTTACGCTGTGACTAGATTTTCCTGACACTACACTGCATCGGAGACTCCTGCTTATGTTTTTACGTTAATCATCTGGAAACTGACGGCTGCAGAGCCTAGAACTGTCACTGCTTGGCCCATTGTTCCTTTTCATCCTTTGCTATTCTCGCTTATCACAATCTACAGTGGGCTTGAAACCTTTTTTTTTTTTTTTTTTTTAATTGCTAAGGACAAAAATAGAAAGTGAGGGGAAAAAAAAGGTCAAACAGTTTTCTCTTGTCATGCCAGAAGCACACTTGAGGCTGCACCAGTAGAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTCAGTAGGAAATCTCTTCTCCGAGCCTGACAAAATCAAGAGTTTATTTCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAGAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATATAGAAAATAATCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTCGGTCCTCATTGGGACCTTTCTCAAGGATAAAAAACAATTTTTTATCCTTGAGAAAGGTCCTAATTTATATTAGAGTTCTCAGGACTGCACTCCTAATAAAATCCATCATGCCTGGAAGCGACTGTTTTTGTCAAATAAAATGAAATGCTATTAATGACAATGTAATCAAGTGCTACATTTTGACTTTATAGCTTTATAGCTAATCTGATTACAACAGCAGATAAAGCTGTATACACCCAATTTTCCTCAAAGGCATTTAATATTTATTTTTTCATCTCTTTCTAATCGTTTTAAATGGGTATTGATACTTAAGAAGTAATAAAATCATATA
                                                  Xt7.1-CHK-1008236904                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTCCTTAGTCATGGTTCACTGCTAGCCAAGAGTTGTCAATCTGCAATGCTATTGGCACATCATGATTCAGAGATTTCGTCAAGGGCTTTCCAATATGGAAAACATATGTCTATCAGTTACAAGCTAAGTTCAGACCTCCAGCCATTCATCAATAGAAAATACAGTGATTCGTTGTTTAGCCTGAATTCTGCTCCAGTGGTTCTTCACCAGGAATTTATTGGAACAGAAGCCTGGATGGAGCAGATCAAAGAGGCTCAACTGAAAGACAACTTGATTGACCGCATAAAGTTGCAAAAGGCAATCAAGGCTGGCAAAGGTGTGACTTCTGCTACTGACCTGTGTTGTTACCATGGAGACAAAGCTCTGGAGGCCCTGCAGTGTTTTCCTGCCTCTGAGGCCAGATCTGCCTTGGAAAACATTATTTACGCTGTGACTAGATTTTCCTGACACTACACTGCATCGGAGACTCCTGCTTATGTTTTTACGTTAATCATCTGGAAACTGACGGCTGCAGAGCCTAGAACTGTCACTGCTTGGCCCATTGTTCCTTTTCATCCTTTGCTATTCTCGCTTATCACAATCTACAGTGGGCTTGAAACCTTTTTTTTTTTTTTTTTTTTAATTGCTAAGGACAAAAATAGAAAGTGAGGGGAAAAAAAAGGTCAAACAGTTTTCTCTTGTCATGCCAGAAGCACACTTGAGGCTGCACCAGTAGAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTCAGTAGGAAATCTCTTCTCCGAGCCTGACAAAATCAAGAGTTTATTTCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAGAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATATAGAAAATAATCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTCGGTCCTCATTGGGACCTTTCTCAAGGATAAAAAACAATTTTTTATCCTTGAGAAAGGTCCTAATTTATATTAGAGTTCTCAGGACTGCACTCCTAATAAAATCCATCATGCCTGGAAGCGACTGTTTTTGTCAAATAAAATGAAATGCTATTAATGACAATGTAATCAAGTGCTACATTTTGACTTTATAGCTTTATAGCTAATCTGATTACAACAGCAGATAAAGCTGTATACACCCAATTTTCCTCAAAGGCATTTAATATTTATTTTTTCATCTCTTTCTAATCGTTTTAAATGGGTATTGATACTTAAGAAGTAATAAAATCATATAATTATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     4     4     3     4     3     4     3     4     3     4     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     6     4     6     4     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PREDICTED - Sp ---- 5e-017     XP_785706.2 PREDICTED: similar to Prenyl (decaprenyl) diphosphate synthase, subunit 2 [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                            PROTEIN --- Dm ---- 1e-018     NP_649277.1 CG10585-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dr ---- 8e-043     NP_001002351.1 zgc:92156 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED - Mm ---- 1e-049     XP_994993.1 PREDICTED: prenyl diphosphate synthase, subunit 2 isoform 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Gg ---- 8e-051     XP_419804.1 PREDICTED: similar to candidate tumor suppressor protein [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Hs ---- 3e-053     NP_065114.2 candidate tumor suppressor protein [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Xt ---- 7e-081     AAH82488.1 MGC88978 protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT32866.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------TAA---------ATG------------------------------------------------------------------------TAA---------------------------------------------------------------TAG------------------------TAA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TGA---------------------------------------------TAG---------TAA------------------TAA---------------------------------TAA------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2       bld TbA                            TTbA056f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTAGTGGCATTTCTGCCAGGCAAAGAAGCCTAGCTGAAATCACGGAACTGATCCACACAGCTTTCCTAGTGCACCGTGGCATTGTAAATATTAATGAATTGAAGACATGCGATGGCCCTATTAAGGACATGCAGTTTGGGAACAAAATGGCGATTCTTAGTGGGGACTTTCTTCTTGCAAATGCATGTATAGGATTATCTGATTTACAGAACGCAAAGGTTGTGGAGATTGTATCTAGTGCCATAGGTGACATGGTAAAAGGAGTATACTATGAAAATTCGTATATGCCAGAGAACACCTTTACAGATGTTAATGGCATATCTAACTGGATGGAGAACATTTTCCTTAGTCATGGTTCACTGCTAGCCAAGAGTTGTCAATCTGCAATGCTATTGGCACATCATGATTCAGAGATTTCGTCAAGGGCTTTCCAATATGGAAAACATATGTCTATCAGTTACAAGCTAAGTTCAGACCTCCAGCCATTCATCAATAGAAAATACAGTGATTCGTTGTTTAGCCTGAATTCTGCTCCAGTGGTTCTTCACCAGGAATTTATTGGAACAGAAGCCTGGATGGAGCAGATCAAAGAGGCTCAACTGAAAGACAACTTTATTGACCGCACAAAGTTGCAAAAGGCAATCAAGGCTGGCAAAGGTGTGACTTCTGCTACTGACCTGTGTTGTTACCATGGAGACAAAGCTCTGGAGGCCCTGCAGTGTTTTCCTGCCTCTGAGGCCAGATCTGCCTTGGGAAACATTATTTACGCTGTGACTAGATTTTCCTGACACTACACTGCATC
  5   1   2      skin Eye       in                         CCAX2982.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACATTTTCCTTAGTCATGGTTCACTGCTAGCCAAGAGTTGTCAATCTGCAATGCTATTGGCACATCATGATTCAGAGATTTCGTCAAGGGCTTTCCAATATGGAAAACATATGTCTATCAGTTACAAGCTAAGTTCAGACCTCCAGCCATTCATCAATAGAAAATACAGTGATTCGTTGTTTAGCCTGAATTCTGCTCCAGTGGTTCTTCACCAGGAATTTATTGGAACAGAAGCCTGGATGGAGCAGATCAAAGAGGCTCAACTGAAAGACAACTTGATTGACCGCATAAAGTTGCAAAAGGCAATCAAGGCTGGCAAAGGTGTGACTTCTGCTACTGACCTGTGTTGTTACCATGGAGACAAAGCTCTGGAGGCCCTGCAGTGTTTTCCTGCCTCTGAGGCCAGATCTGCCTTGGAAAACATTATTTACGCTGTGACTAGATTTTCCTGACACTACACTGCATCGGAGACTCCTGCTTATGTTTTTACGTTAATCATCTGGAAACTGACGGCTGCAGAGCCTAGAACTGTCACTGCTTGGCCCATTGTTCCTTTTCATCCTTTGCTATTCTCGCTTATCACAATCTACAGTGGGCTTGAAACCTTTTTTTTTTTTTTTTTTTTTAATTGCTAAGGACAAAAATAGAAAGTGAGGGGGAAAAAAAAGGTCAAACAGTTTTCTCTTGGTCATGCCAGAAGCACACTTGAGG
  5   1   2       bld Egg                            TEgg084k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGATCAAAGAGGCTCAACTGAAAGACAACTTGATTGACCGCATAAAGTTGCAAAAGGCAATCAAGGCTGGCAAAGGTGTGACTTCTGCTACTGACCTGTGTTGTTACCATGGAGACAAAGCTCTGGAGGCCCTGCAGTGTTTTCCTGCCTCTGAGGCCAGATCTGCCTTGGAAAACATTATTTACGCTGTGACTAGATTTTCCTGACACTACACTGCATCGGAGACTCCTGCTTATGTTTTTACGTTAATCATCTGGAAACTGACGGCTGCAGAGCCTAGAACTGTCACTGCTTGGCCCATTGTTCCTTTTCATCCTTTGCTATTCTCGCTTATCACAATCTACAGTGGGCTTGAAACCTTTTTTTTTTTTTTTTTTTTAATTGCTAAGGACAAAAATAGAAAGTGAGGGGAAAAAAAAGGTCAAACAGTTTTCTCTTGTCATGCCAGAAGCACACTTGAGGCTGCACCAGTAGAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTC
  5   1   2      seed Tad5                                 XZT32866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGACTCCTGCTTATGTTTTTACGTTAATCATCTGGAAACTGACGGCTGCAGAGCCTAGAACTGTCACTGCTTGGCCCATTGTTCCTTTTCATCCTTTGCTATTCTCGCTTATCACAATCTACAGTGGGCTTGAAACCTTTTTTTTTTTTTTTTTTTTTAATTGCTAAGGACAAAAATAGAAAGTGAGGGGAAAAAAAAGGTCAAACAGTTTTCTCTTGTCATGCCAGAAGCACACTTGAGGCTGCACCAGTAGAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTCAGTAGGAAATCTCTTCTCCGAGCCTGACAAAATCAAGAGTTTATTTCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAGAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATATAGAAAATAATCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTCGGTCCTCATTGGGACCTTTCTCAAGGATAAAAACAATTTTTTATCCTTG
  5   1   2       bld HdA                            THdA033n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAACTAGTGTCGACGCGGCCGCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATTGCCAAGGACAAAAATAGAAAGTGAGGGGAAAAAAAAGGTCAAACAGTTTTCTCTTGTCATGCCAAAAGCACACTTGAGGCTGCACCAGTAAAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTCAGTAGGAAATCTCTTCTCCGAGCCTGACAAAATCAAGAGTTTATTTCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAAAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATATAGAAAATAATCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTCGGTC
  3   1   2       bld Egg  5g3  out                   TEgg046n01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAAGGTCAAACAGTTTTCTCTTGTCATGCCAGAAGCACACTTGAGGCTGCACCAGTAGAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTCAGTAGGAAATCTCTTCTCCGAGCCTGACAAAATCAAGAGTTTATTTCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAGAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAGTGGTGTCCGCACTCCAAGGCTCGGTGTTCTGCGGGGTGCATGGCCAAAGTTGTGTATATATAGAAAATGGTCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTAGGGCCTCATTGGGACCTTTCTCAGGGATAAAAAACAATTTTTTATCCTTANNAAANNTCCTAATTNGTCCAAGGGGAGGAGACTNCACTCCTNNTNAAAACCCGGGGGGGGGGGGTGGGCTTTTTTTCAAATAAAATGAAATGGGATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg030m08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAGGTCAAACAGTTTTCTCTTGTCATGCCAGAAGCACACTTGAGGCTGCACCAGTAGAAATAATTAATGAGGTTTGCTTCTGTGACCTCAGCAAATGGCCAGGAAATAAGTCCTTATTGATTGGACATAGCCAGGAGTGGCGCCAGTGTGGTGGCCTGTGGTTTTCCTGCTCCTAGGAGGACATAAGGGGTGTGATTCTGCAGGTGTCAGTAGGAAATCTCTTCTCCGAGCCTGACAAAATCAAGAGTTTATTTCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAGAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATACTCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATA
  3   1   2       bld Eye       in                         CCAX2982.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAAGAGTTTATTTCCATTATAGACTTCGCATCAAGGACACTCCTAATTTATAGGAAACCTGGAAGCAACCGCGTTCAGAAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATATAGAAAATAATCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTCGGTCCTCATTAGGACCTTTCTCAAGGATAAAAAACAATTTTTTATCCTTGAGAAAGGTCCTAATTTATATTAGAGTTCTCAGGACTGCACTCCTAATAAAATCCATCATGCCTGGAAGCGACTGTTTTTGTCAAATAAAATGAAATGCTATTAATGACAATGTAATCAAGTGCTACATTTTGACTTTATAGCTTTATAGCTAATCTGATTACAACAGCAGATAAAGCTGTATACACCCAATTTTCCTCAAAGGCATTTAATATTTATTTTTTCATCTCTTTCTAATCGTTTTAAATGGGTATTGATACTTAAGAAGTAATAAAATCATATAATTATCTTTTA
  3   1   2       bld Egg       in                    TEgg030m08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTATTTCATTATAGACTTCGCATCAAGNGACACTCCTAATTTTATAGGAAACCTGGAAGCAACCGCGTTCAGAATCAGCATCAGCAATCGGGTTTTAATGTTTTTTTATGTTCTGCACATTCAAGTCACTCTCACTCTGCATAAAACAAAAGATATTTACATTTGTTATATACCTATATGTGTAATATATATATATAATCAATTCAAATGGTGTCCGCACTCCAAGGCTCAATATTCTGCGGGGTGCATAGCCAAAATTATGTATATATAGAAAATAATCATCTATTATTCCAATGCTTTATCAAAAATTTATTGAAAATATATTGTTAAAACCGACGTTTCGGTCCTCATTGGGACCTTTCTCAAGGATAAAAAACAATTTTTTATCCTTGAGAAAGGTCCTAATTTATATTAGAGTTCTCAGGACTGCACTCCTAATAAAATCCATCATGCCTGGAAGCGACTGTTTTTGTCAAATAAAATGAAATGCTATTAATGACAATGTAATCAAGTGCTACATTTTGACTTTATAGCTTTATAGCTAATCTGATTACAACAGCAGATAAAGCTGTATACACCCAATTTTCCTCAAAGGCATTTAATATTTATTTTTTCATCTCTTTCTAATCGTTTTAAATGGGTATTGATACTTAAGAAGTAATAAAATCATATAATTATCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)