Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 299.0    0Xt7.1-CBSU1192.5                           28 PI      77         30      534                PREDICTED: similar to myosin L2B regulatory light chain, cardiac muscle - chicken [Gallus gallus]

 This cluster: approximate FL confidence score = 90%

 1012089925 Xt7.1-XZT62205.5 - 4 ESTs
                                                                       ........-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT62205.5                                                 CTAATTCTAAGCAACTTTCCAATCATACCACAGCACAACAATGTCACCCAAGAAAGCAAAGAAGAGAGCAGAGGGGGCCAACTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACCATTATGGACCAGAACCGAGATGGATTCATTGACAAAGAAGATCTTAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTGAAAAATGAAGAACTGGAAGAAATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTTCTGACCATGTTTGGAGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACTATTTTAAATGCATTCAAAGTGTTTGACCCTGAGGGAACTGGACTTCTCAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGTGAAGAGGTTGATCAGATGTTCACAGCTTTCCCCCCTGACGTAACTGGAAACTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATAATATAGTTGTGCAATGGTCTTGCTCTTCTCTTACCAACCCCACGGCGCTCAGAGTTTTGTTTTCCATCTACTGTATGTCTGCTTGCTGTATTTAGTCTACACTTTGCCCTTCACAATCTGTGTTTACTGTGACCATCTGTAAAATAATAAATATTATTTCTCTACATCATATCTAATACAGGTATTTATTATGTTGCTTTAATGTCCTAAGTACAAAGCAGTGACGGTAACAAGATT
                                                  Xt7.1-CHK-1008244752                                                       CTAAGCAACTTTCxxxTCATACCACAGCACAACAATGTCACCCAAGAAAGCAAAGAAGAGAGCAGAGGGGGCCAACTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACCATTATGGACCAGAACCGAGATGGATTCATTGACAAAGAAGATCTTAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTGAAAAATGAAGAACTGGAAGAAATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTTCTGACCATGTTTGGAGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACTATTTTAAATGCATTCAAAGTGTTTGACCCTGAGGGAACTGGACTTCTCAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGTGAAGAGGTTGATCAGATGTTCACAGCTTTCCCCCCTGACGTAACTGGAAACTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATAATATAGTTGTGCAATGGTCTTGCTCTTCTCTTACCAACCCCACGGCGCTCAGAGTTTTGTTTTCCATCTACTGTATGTCTGCTTGCTGTATTTAGTCTACACTTTGCCCTTCACAATCTGTGTTTACTGTGACCATCTGTAAAATAATAAATATTATTTCTCTACATCATATCTAATACAGGTATTTATTATGTTGCTTTAATGTCCTAAGTACAAAGCAGTGACGGTAAC
                                                      consensus depths                                                      1     2     1     2     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG      40     217                                                 
                                               BLH MIN      40      95                                                 
                                               BLH MPR      19      95                                                 
                                               BLH OVR      40     319                                                 
                                               ORF LNG      40       5                                                 
                                                                                                                                                                                                               PROTEIN === Sc ==== 6e-016     NP_009667.1 master regulator of calcium mediated signalling; Cmd1p [Saccharomycescerevisiae] ====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN --- Bf ---= 6e-023     BAA19787.1 calmodulin [Branchiostoma floridae] ==================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN --- Br ---= 4e-023     CAB38169.1 calmodulin 2 [Branchiostoma lanceolatum] =============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                               PROTEIN --- Ci ---= 6e-023     BAC57528.1 calmodulin homologue [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                            PROTEIN --- Bb ==== 7e-031     BAA96550.1 myosin regulatory light chain [Branchiostoma belcheri] =======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === Br ==== 5e-037     ABE73475.1 myosin regulatory light chain [Branchiostoma belcheri tsingtaunese] ==============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                      PROTEIN --- Ce ---- 1e-042     NP_497700.1 Myosin light chain MLC-4 (19.9 kD) (mlc-4) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                          PROTEIN --- Dm ---- 2e-043     NP_511057.1 CG3595-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                PREDICTED - Sp ---- 1e-052     XP_783666.1 PREDICTED: similar to Myosin regulatory light chain 2, nonsarcomeric (Myosin RLC) [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === Xt ==== 2e-067     AAY90073.1 MLC2 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === Dr ==== 5e-078     NP_001035134.1 myosin, light polypeptide 2, regulatory, cardiac, slow [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PREDICTED = Gg ==== 1e-081     XP_415166.1 PREDICTED: similar to Myosin regulatory light chain 2A, cardiac muscle isoform (G2) (MLC-2A) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === Mm ==== 1e-081     NP_034991.2 myosin, light polypeptide 2, regulatory, cardiac, slow [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === Hs ==== 9e-084     NP_000423.2 slow cardiac myosin regulatory light chain 2 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === Xl ==== 2e-089     AAH78537.1 MGC85379 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                               PROTEIN === ?? ==== 2e-089     NP_001087308.1 MGC85379 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT62205.5                                                  TAA---TAA------------------------------ATG------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------ATG---------------------------------------------------------------------------------------TAA------------ATG---------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------ATG------TAA
                                                                   ORF                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  3   1   2       bld Bone      out                       CBTC3197.rev GGGACATGTCAACNCCAGAAATATTTTTTTTGCCTAGTGAAAAAAAATCTAATTCTAAGCAACTTTCCAATCTCAATTTATTAAAAATTATTAGTGCTTTAAAAGTTATTTGTAAATGTAATTGCTATAGAAAGCAGCATTTGCTGAACTCCTGGTTGTTACTTTTTAAACAATGTTGCAAGTGCCCGGCTCCTCCAGCAAGTCAGGTCTGTCAATCTGCTGCCTTGTGTTAAGCGCCAGAGCCACCAGGGCAGGGAATAGAAAGAACAGGCAGACACTACTTTTAATAGCAGTTATATATACAAATAACTAAAAAAAATTACAAATATGTAATGAATGTATATTGAAAATTTGCTTGGAATTAGGTTTTTTTTTGTTAGGCAAGGGATTATTTTTGGGGGTGACATGTTCTTTGTGTAAGTGTAATGCATAATTTTTGTATTTGCAAAATGAAAAAAAAAACAGTGATCTGCAATGATTTTTCTTACAGGTTGATCAGATGTTCACAGCTTTCCCCCCTGACGTAACTGGAAACTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATAATATAGTTGTGCAATGGTCTTGCTCTTCTCTTACCAACCCCACGGCGCTCAGAGTTTTGTTTTCCATCTACTGTATGTCTGCTTGCTGTATTTAGTCTACACTTTGCCCTTCACAATCTGTGTTTACTGTGACCATCTGTAAAATAATAAATATTATTTCTCTACATCAT
  3   1   2       chi Limb      in                        CBSU6346.rev                                              TCGACCCACGCGTCCGAAGAACATCTCATACCACAGCACAACAATGTCACCCAAGAAAGCAAAGAAGAGAGCAGAGGGGGCCAACTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACCATTATGGACCAGAACCGAGATGGATTCATTGACAAAGAAGATCTTAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTGAAAAATGAAGAACTGGAAGAAATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTTCTGACCATGTTTGGAGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACTATTTTAAATGCATTCAAAGTGTTTGACCCTGAGGGAACTGGACTTCTCAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGTGAAGAGGTTGATCAGATGTTCACAGCTTTCCCCCCTGACGTAACTGGAAACTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATAATATAGTTGTGCAATGGTCTTGCTCTTCTCTTACCAACCCCACGGCGCTCAGAGTTTTGTTTTCCATCTACTGTATGTCTGCTTGCTGTATTTAGTCTACACTTTGCCCTTCACAATCTGTGTTTACTGTGACCATCTGTAAAATAATAAATATTATTTCTCTACATCAT
  5   1   2   32 seed Tad5 PIPE                            XZT62205.5p .............................................................AAGAACATCTCATACCACAGCACAACAATGTCACCCAAGAAAGCAAAGAAGAGAGCAGAGGGGGCCAACTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACCATTATGGACCAGAACCGAGATGGATTCATTGACAAAGAAGATCTTAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTGAAAAATGAAGAACTGGAAGAAATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTTCTGACCATGTTTGGAGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACTATTTTAAATGCATTCAAAGTGTTTGACCCTGAGGGAACTGGACTTCTCAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGTGAAGAGGTTGATCAGATGTTCACAGCTTTCCCCCCTGACGTAACTGGAAACTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATAATATAGTTGTGCAATGGTCTTGCTCTTCTCTTACCAACCCCACGGCGCTCAGAGTTTTGTTTTCCATCTACTGTATGTCTGCTTGCTGTATTTAGTCTACACTTTGCCCTTCACAATCTGTGTTTACTGTGACCATCTGTAAAATAATAAATATTATTTCTCTACATCATATCTAATACAGGTATTTATTATGTTGCTTTAATGTCCTAAGTACAAAGCAGTGACGGTAACAAGATTTCAG
  5   1   2       chi Limb      in                        CBSU6346.fwd                                                               AGAACATCTCATACCACAGCACAACAATGTCACCCAAGAAAGCAAAGAAGAGAGCAGAGGGGGCCAACTCTAATGTGTTCTCCATGTTTGAGCAAACACAGATCCAGGAATTTAAAGAGGCTTTTACCATTATGGACCAGAACCGAGATGGATTCATTGACAAAGAAGATCTTAGAGATACTTTTGCTGCATTAGGTCGACTGAATGTGAAAAATGAAGAACTGGAAGAAATGCTAAAAGAAGCTCCAGGACCAATCAACTTTACAGTGTTTCTGACCATGTTTGGAGAGAAGTTAAAGGGAGCTGATCCAGAAGAAACTATTTTAAATGCATTCAAAGTGTTTGACCCTGAGGGAACTGGACTTCTCAAATCAGAATACATTCGAGAAATGCTCATGACTCAGGCAGAAAGATTTACAAGTGAAGAGGTTGATCAGATGTTCACAGCTTTCCCCCCTGACGTAACTGGAAACTTAAACTACAAAAACCTTGTGCATATTATCACTCACGGTGAAGAGAAGGAGGAATAATATAGTTGTGCAATGGTCTTGCTCTTCTCTTACCAACCCCACGGCGCTCAGAGTTTTGTTTTCCATCTACTGTATGTCTGCTTGCTGTATTTAGTCTACACTTTGCCCTTCACAATCTGTGTTTACTGTGACCATCTGTAAAATAATAAATATTATTTCTCTACATCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)