Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAP6371.3.5                         28 END     2          50        7                MGC86262 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 193.0    0Xt7.1-CABL715.5.5                          47 PI      94        861      979                APG12 autophagy 12-like; Apg12 (autophagy, yeast) homolog; Apg12 (autophagy 12,S. cerevisiae)-like [Homo sapiens]
     3 183.0    0Xt7.1-CAAQ3674.5                            4 PI      92        861      986                (no blast hit)
     4 200.0    0Xt7.1-CABK9098.3                            2 PI      94        861      986                (no blast hit)
     5 174.0    0Xt7.1-CABA3210.5                            2 PI      90        861      990                hypothetical protein MGC33190 [Homo sapiens]
     6 176.0    0Xt7.1-CABA11352.5                           2 PI      90        862      989                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012089985 Xt7.1-CABK1458.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK1458.5 AGAAGCCGCACAAACCCCTCCAGCGGGGAGGAGGCGAGAGGCTGAGCCCGCCCCGAGCAAAGAGAAAACAAGGAAACTGAAAGAGGCAGGAGTGCGGCTGTGCGCCCGGGCTCTCACTTTTCTGCCCTTCGCTGCAATGGACAGCTAGACAGGAGCCCGCTGAGGAGGTGTCATTCATTATCTGGCTCGCACGGCAGCGCGTCCTGTCCATCACCAACACGCAATTCTTTGCATTACTGCGGCTGTCACTCATTTACTCAATCGGGAAAGACGGCCAGTAACTATAACCAGTGCAAGATCAATGATGGCGCAAAACATATATGATATTGATGCTCATCTGGATACATATTTACCAATAAACCCTTTATTTCAAGAACCTATTTATATGACTTCTGAGCCAAATCTTCGAAGTGCTGAAGGGCCATACATTGAAATCACAGAGCAACCAAAACAGAGAGGGTTTCGCTTTCGATATGTCTGTGAAGGGCCGTCACATGGAGGACTTCCTGGGGCTTCGAGTGAAAAAAACAAAAAGTCATACCCACAGATTAAGATTCATAATTATGTTGGTCAAGTTAAGATTATAGTGCAGCTGATAACCAATAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGACGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTGCTAACCTGGGAATACTTCATGTTACAAAGAAGAAAGTGATTGAGATTCTGGAGGCCCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACATCCAGAGCTCAATTATACATACTCTGAAGATAGACAATTAAATGTGCAGAAAAAGGAAATCAATTTTTAAAATCTGAATTATTTGCTTATAATGGAGTCTATGGGAGACATGCTTTCCATAATTCGGAGCTTTCTTGATATCGGGTTTCCAGATAAGGGATCCCATGTCTGTACTAAGTGGGTATGATCTTTCGATTTACTTGATATGACCATCTTATATACACTTCCCAAGGCTTTGGAAAT
                                                  Xt7.1-CHK-1008246746       CGCACAAACCCCTCCAGCGGGGAGGAGGCGAGAGGCTGAGCCCGCCCCGAGCAAAGAGAAAACAAGGAAACTGAAAGAGGCAGGAGTGCGGCTGTGCGCCCGGGCTCTCACTTTTCTGCCCTTCGCTGCAATGGACAGCTAGACAGGAGCCCGCTGAGGAGGTGTCATTCATTATCTGGCTCGCACGGCAGCGCGTCCTGTCCATCACCAACACGCAATTCTTTGCATTACTGCGGCTGTCACTCATTTACTCAATCGGGAAAGACGGCCAGTAACTATAACCAGTGCAAGATCAATGATGGCGCAAAACATATATGATATTGATGCTCATCTGGATACATATTTACCAATAAACCCTTTATTTCAAGAACCTATTTATATGACTTCTGAGCCAAATCTTCGAAGTGCTGAAGGGCCATACATTGAAATCACAGAGCAACCAAAACAGAGAGGGTTTCGCTTTCGATATGTCTGTGAAGGGCCGTCACATGGAGGACTTCCTGGGGCTTCGAGTGAAAAAAACAAAAAGTCATACCCACAGATTAAGATTCATAATTATGTTGGTCAAGTTAAGATTATAGTGCAGCTGATAACCAATAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGACGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTGCTAACCTGGGAATACTTCATGTTACAAAGAAGAAAGTGATTGAGATTCTGGAGGCCCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACATCCAGAGCTCAATTATACATACTCTGAAGATAGACAATTAAATGTGCAGAAAAAGGAAATCAATTTTTAAAATCTGAATTATTTGCTTATAATGGAGTCTATGGGAGACATGCTTTCCATAATTCGGAGCTTTCTTGATATCGGGTTTCCAGATAAGGGATCCCATGTCTGTACTAAGTGGGTATGATCTTTCGATTTACTTGATATGACCATCTTATATACACTTCCCAAGGCTTTGGAAATTACCTG
                                                      consensus depths      1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     1     1
                                               BLH ATG     301     166 
                                               BLH MIN     304      62 
                                               BLH MPR     211      62 
                                               BLH OVR     301     876 
                                               CDS MIN     301      62 
                                               ORF LNG     301      26 
                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 3e-023     NP_724052.1 dorsal CG6667-PA [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 3e-038     AAH76882.1 MGC88936 protein [Xenopus tropicalis] -------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                          PROTEIN --- Sp ---- 5e-039     NP_999819.1 NFkB protein [Strongylocentrotus purpuratus] -----------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 5e-042     BAE06579.1 NFkB protein [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dr ---- 1e-042     NP_001001840.2 P100/P52 transcription factor [Danio rerio] ---=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ---- 3e-065     NP_032715.2 nuclear factor kappa-B, subunit 1 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ---- 8e-066     NP_003989.2 nuclear factor kappa-B, subunit 1 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Gg ---- 9e-069     NP_990465.1 NF-kB p50 subunit [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 5e-098     AAH81252.1 MGC86262 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 5e-098     NP_001087808.1 MGC86262 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK1458.5                                                                                                                                         ATG------TAG------------TGA------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------------------ATG------ATG------ATG------------------------------------------------------------------------TGA------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2   14  bld Te4  5g3  out                        CAAN9841.5p AGAAGCCGCACAAACCCCTCCAGCGGGGAGGAGGCGAGAGGCTGAGCCCGCCCCGAGCAAAGAGAAAACAAGGAAACTGAAAGAGGCAGGAGTGCGGCTGTGCGCCCGGGCTCTCACTTTTCTGCCCTTCGCTGCAATGGACAGCTAGACAGGAGCCCGCTGAGGAGGTGTCATTCATTATCTGGCTCGCACGGCAGCGCGTCCTGTCCATCACCAACACGCAATTCTTTGCATTACTGCGGCTGTCACTCATTTACTCAATCGGGAAAGACGGCCAGTAACTATAACCAGTGCAAGATCAATGATGGCGCAAAACATATATGATATTGATGCTCATCTGGATACATATTTACCAATAAACCCTTTATTTCAAGAACCTATTTATATGACTTCTGAGCCAAATCTTCGAAGTGCTGAAGGGCCATACATTGAAATCACAGAGCAACCAAAACAGAGAGGGTTTCGCTTTCGATATGTCTGTGAAGGGCCGTCACATGGAGGACTTCCTGGGGCTTCGAGTGAAAAAAACAAAAAGTCATACCCACAGATTAAGATTCATAATTATGTTGGTCAAGTTAAGATTATAGTGCAGCTGATAACCAATAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGACGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGTGCGGGAAAAGGAAATCATAAGACAGGCAGCAATGCAGCAGGCCAAGGATATAGACCTAAGTGTGGTGCGACTCATGTTCACTGCCTTCCTGCCAGATAGC
  5   1   2   14  bld Te4  5g3  out                        CAAN3780.5p ................................................................................AAGAGGCAGGAGTGCGGCTGTGCGCCCGGGCTCTCACTTTTCTGCCCTTCGCTGCAATGGACAGCTAGACAGGAGCCCGCTGAGGAGGTGTCATTCATTATCTGGCTCGCACGGCAGCGCGTCCTGTCCATCACCAACACGCAATTCTTTGCATTACTGCGGCTGTCACTCATTTACTCAATCGGGAAAGACGGCCAGTAACTATAACCAGTGCAAGATCAATGATGGCGCAAAACATATATGATATTGATGCTCATCTGGATACATATTTACCAATAAACCCTTTATTTCAAGAACCTATTTATATGACTTCTGAGCCAAATCTTCGAAGTGCTGAAGGGCCATACATTGAAATCACAGAGCAACCAAAACAGAGAGGGTTTCGCTTTCGATATGTCTGTGAAGGGCCGTCACATGGAGGACTTCCTGGGGCTTCGAGTGAAAAAAACAAAAAGTCATACCCACAGATTAAGATTCATAATTATGTTGGTCAAGTTAAGATTATAGTGCAGCTGATAACCAATAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGACGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTGCTAACCTGGGAATACTTCATGTTACAAAGAAGAAAGTGATTGAGATTCTGGAGGCCCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACATCCAGAGCTCAATTATACATACTCTGAAGATAGACAATTAAATGTGCGGGAAAAGGAAATCATAAGACAGGCAGCAATGCAGCAGGCCAAGGATATAGACCTAAGTGTGGTGCGACTCATGTTCACTGCCTTCCCTGCAGATAGCGAAGGTCGATTTACTAGATCACTTGAGC
  5   1   2   10 seed Spl1 5g3  in                         CABK1458.5p .........................................................................................................................................................AGCCCGCTGAGGAGGTGTCATTCATTATCTGGCTCGCACGGCAGCGCGTCCTGTCCATCACCAACACGCAATTCTTTGCATTACTGCGGCTGTCACTCATTTACTCAATCGGGAAAGACGGCCAGTAACTATAACCAGTGCAAGATCAATGATGGCGCAAAACATATATGATATTGATGCTCATCTGGATACATATTTACCAATAAACCCTTTATTTCAAGAACCTATTTATATGACTTCTGAGCCAAATCTTCGAAGTGCTGAAGGGCCATACATTGAAATCACAGAGCAACCAAAACAGAGAGGGTTTCGCTTTCGATATGTCTGTGAAGGGCCGTCACATGGAGGACTTCCTGGGGCTTCGAGTGAAAAAAACAAAAAGTCATACCCACAGATTAAGATTCATAATTATGTTGGTCAAGTTAAGATTATAGTGCAGCTGATAACCAATAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGACGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTGCTAACCTGGGAATACTTCATGTTACAAAGAAGAAAGTGATTGAGATTCTGGAGGCCCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACATCCAGAGCTCAATTATACATACTCTGAAGATAGACAATTAAATGTGCagaanaaggaaatcaatttttaaaatctgaattatttgcttataatggagtctatgggagacatgctttccataattcggagctttcttgatatcgggtttccagataagggatcccatgtctgtacTAAGTGGGTATGATCTTTCGATTTACTTGATATGACCATCTTATATACACTTCCCAAGGCTTTTG
  3   1   2       bld Spl1 5g3  in                         CABK1458.3p                                                                                                                                                                                                                                       GCATTACTGCGGCTGTCACTCATTTACTCAATCGGGAAAGACGGCCAGTAACTATAACCAGTGCAAGATCAATGATGGCGCAAAACATATATGATATTGATGCTCATCTGGATACATATTTACCAATAAACCCTTTATTTCAAGAACCTATTTATATGACTTCTGAGCCAAATCTTCGAAGTGCTGAAGGGCCATACATTGAAATCACAGAGCAACCAAAACAGAGAGGGTTTCGCTTTCGATATGTCTGTGAAGGGCCGTCACATGGAGGACTTCCTGGGGCTTCGAGTGAAAAAAACAAAAAGTCATACCCACAGATTAAGATTCATAATTATGTTGGTCAAGTTAAGATTATAGTGCAGCTGATAACCAATAGCAAAGACATCCGACTGCATGCCCATAGTCTAGTTGGTAAAAACTGTGAAGACGGCATCTGTTCTCTAACTGTAGGACCTAAAGATACAATTGTTGGGTTTGCTAACCTGGGAATACTTCATGTTACAAAGAAGAAAGTGATTGAGATTCTGGAGGCCCGCATGACAGATGCCTTCAAAAAGGGACACAATGCTGCATTATTAGTACATCCAGAGCTCAATTATACATACTCTGAAGATAGACAATTAAATGTGCagaaaaaggaaatcaatttttaaaatctgaattatttgcttataatggagtctatgggagacatgctttccataattcggagctttcttgatatcgggtttccagataagggatcccatgtctgtacTAAGTGGGTATGATCTTTCGATTTACTTGATATGACCATCTTATATACACTTCCCAAGGCTTTGGAAATTACCTGAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)