Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABA6296.5                           19 END     3          75       15                brain factor-1; XBF-1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012090020 Xt7.1-XZT48583.5 - 4 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT48583.5 AATTAATTGTAGCTATAGCTGTCTACTCTAGATGCACAGAGGGGACGCTTGTTGTGTTTATTTTGAAGGGACATGAAATAGTTTGCTGCATTCTCTCCCCTGGCTCGCACCCTGATTATATTTATATGTATATGTATTTACAGCCCTTTAATTGACGCCAATATTATGTGCGTTTGGTTTTTTGCTTCATGACTTACAAGTGTTTGGAGACGGTGGTGCGACAGAGCTGCTGCTGCGGCTGCTTCCTACTGCTGCGACTTGACTCGAGTGTCCGGCTCCAATCCTTGTGATATGTTGGACATGGGGGATAGGAAGGAAGTTAAAATGATCCCCAAGTCGTCGTTCAGTATCAACAGCCTAGTGCCTGAAGCCGTGCAAAATGACAACCATCCCCAGCCGCACCATCACCACCACCACCACCTGCAACTGCCGCAGCAGTCGCACCATCTGCAGCCCCACCACCGGCCGCTACAGGAGGAGGACGAGCTGGACAAGAGCCTCCTGGAAGTGAAGACAGAGAGCCTCCCCCCGGGTAAGGGAGACCCGGCTGCCTCCGAGCTGCCCGGGGAGGACAAGGAGAAGAGTGAGGACAAGAAGGCGGATGGTGGCGGCGGCAAAGATGGGGAGAATGGGAAGGAAGGGGGCGAGAAGAAGAACGGCAAGTACGAGAAGCCCCCCTTTTCCTACAATGCCCTGATCATGATGGCTATCCGCCAGAGCCCGGAGAAGCGCCTCACCCTCAATGGCATCTACGAGTTCATCATGAAGAACTTCCCCTACTACCGGGAGAACAAGCAGGGCTGGCAGAACTCCATCCGCCACAACCTCAGCCTCAACAAGTGCTTCGTCAAGGTGCCCCGCCAC
                                                  Xt7.1-CHK-1008244640       TTGTAGCTATAGCTGTCTACTCTAGATGCACAGAGGGGACGCTTGTTGTGTTTATTTTGAAGGGACATGAAATAGTTTGCTGCATTCTCTCCCCTGGCTCGCACCCTGATTATATTTATATGTATATGTATTTACAGCCCTTTAATTGACGCCAATATTATGTGCGTTTGGTTTTTTGCTTCATGACTTACAAGTGTTTGGAGACGGTGGTGCGACAGAGCTGCTGCTGCGGCTGCTTCCTACTGCTGCGACTTGACTCGAGTGTCCGGCTCCAATCCTTGTGATATGTTGGACATGGGGGATAGGAAGGAAGTTAAAATGATCCCCAAGTCGTCGTTCAGTATCAACAGCCTAGTGCCTGAAGCCGTGCAAAATGACAACCATCCCCAGCCGCACCATCACCACCACCACCACCTGCAACTGCCGCAGCAGTCGCACCATCTGCAGCCCCACCACCGGCCGCTACAGGAGGAGGACGAGCTGGACAAGAGCCTCCTGGAAGTGAAGACAGAGAGCCTCCCCCCGGGTAAGGGAGACCCGGCTGCCTCCGAGCTGCCCGGGGAGGACAAGGAGAAGAGTGAGGACAAGAAGGCGGATGGTGGCGGCGGCAAAGATGGGGAGAATGGGAAGGAAGGGGGCGAGAAGAAGAACGGCAAGTACGAGAAGCCCCCCTTTTCCTACAATGCCCTGATCATGATGGCTATCCGCCAGAGCCCGGAGAAGCGCCTCACCCTCAATGGCATCTACGAGTTCATCATGAAGAACTTCCCCTACTACCGGGAGAACAAGCAGGGCTGGCAGAACTCCATCCGCCACAACCTCAGCCTCAACAAGTGCTTCGTCAAGGTGCCCCGCCACTACGAT
                                                      consensus depths      1     1     1     1     1     2     1     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1
                                               BLH ATG     291     480 
                                               BLH MIN     291      83 
                                               BLH MPR     159      83 
                                               BLH OVR     291     491 
                                               CDS MIN     291      83 
                                               ORF LNG     291       9 
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Br ---- 2e-016     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sc ---- 3e-018     NP_009991.2 Dosage-dependent suppressor of cmd1-1 mutation; shows homology to fork headfamily of DNA-binding proteins; Hcm1p [Saccharomyces cerevisiae] ============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Bb ==== 2e-021     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] =============================================================================================
                                                                                                                                                                                                                                                        PROTEIN --- Cs ---- 4e-022     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 6e-026     NP_001007864.1 foxc1-prov protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 2e-027     BAE06438.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 5e-030     NP_508644.1 ForKHead transcription factor family member (30.4 kD) (fkh-2) [Caenorhabditiselegans] ------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      REMOVED --- Dm ---- 3e-038     NP_476834.1 PROBABLY REMOVED OR REPLACED [Drosophila melanogaster]  ---------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bf ---- 3e-040     AAC18392.1 transcription factor BF-1 [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 4e-039     XP_788681.2 PREDICTED: similar to forkhead transcription factor G [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 1e-066     NP_571142.1 forkhead box G1; brain factor 1 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 5e-068     NP_032267.1 forkhead box G1 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 3e-068     NP_005240.3 forkhead box G1B [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 5e-072     NP_990524.1 brain factor-1 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 2e-102     AAC79501.1 brain factor-1; XBF-1 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === ?? ==== 2e-102     NP_001079165.1 winged-helix transcription factor [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT48583.5    TAA---TAG---TAG---------------------------------------------TGA------ATG---TAG------------------------------------------------------------------------------------ATG---------------------TGA---------------------------------------------------------------------------------------------------ATG------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2   12  bld Tad5 5g3  out                        XZT55330.5p AATTAATTGTAGCTATAGCTGTCTACTCTAGATGCACAGAGGGGACGCTTGTTGTGTTTATTTTGAAGGGACATGAAATAGTTTGCTGCATTCTCTCCCCTGGCTCGCACCCTGATTATATTTATATGTATATGTATTTACAGCCCTTTAATTGACGCCAATATTATGTGCGTTTGGTTTTTTGCTTCATGACTTACAAGTGTTTGGAGACGGTGGTGCGACAGAGCTGCTGCTGCGGCTGCTTCCTACTGCTGCGACTTGACTCGAGTGTCCGGCTCCAATCCTTGTGATATGTTGGACATGGGGGATAGGAAGGAAGTTAAAATGATCCCCAAGTCGTCGTTCAGTATCAACAGCCTAGTGCCTGAAGCCGTGCAAAATGACAACCATCCCCAGCCGCACCATCACCACCACCACCACCTGCAACTGCCGCAGCAGTCGCACCATCTGCAGCCCCACCACCGGCCGCTACAGGAGGAGGACGAGCTGGACAAGAGCCTCCTGGAAGTGAAGACAGAGAGCCTCCCCCCGGGTAAGGGAGACCCGGCTGCCTCCGAGCTGCCCGGGGAGGACAAGGAGAAGAGTGAGGACAAGAAGGCGGATGGTGGCGGCGGCAAAGATGGGGAGAATGGGAAGGAAGGGGGCGAGAAGAAGAACGGCAAGTACGAGAAGCCCCCCTTTTCCTACAATGCCCTGATCATGATGGCTATCCGCCAGAGCCCGGAGAAGCGCCTCACCCTCAATGGCATCTACGAGTTCATCATGAAGAACTTCCCCTACTACCGGG
  5   1   2   12 seed Tad5 5g3  out                        XZT48583.5p .....................CGGACGCGTGGGCGGACGCGTGGGCGCTTGTTGTGTTTATTTTGAAGGGACATGAAATAGTTTGCTGCATTCTCTCCCCTGGCTCGCACCCTGATTATATTTATATGTATATGTATTTACAGCCCTTTAATTGACGCCAATATTATGTGCGTTTGGTTTTTTGCTTCATGACTTACAAGTGTTTGGAGACGGTGGTGCGACAGAGCTGCTGCTGCGGCTGCTTCCTACTGCTGCGACTTGACTCGAGTGTCCGGCTCCAATCCTTGTGATATGTTGGACATGGGGGATAGGAAGGAAGTTAAAATGATCCCCAAGTCGTCGTTCAGTATCAACAGCCTAGTGCCTGAAGCCGTGCAAAATGACAACCATCCCCAGCCGCACCATCACCACCACCACCACCTGCAACTGCCGCAGCAGTCGCACCATCTGCAGCCCCACCACCGGCCGCTACAGGAGGAGGACGAGCTGGACAAGAGCCTCCTGGAAGTGAAGACAGAGAGCCTCCCCCCGGGTAAGGGAGACCCGGCTGCCTCCGAGCTGCCCGGGGAGGACAAGGAGAAGAGTGAGGACAAGAAGGCGGATGGTGGCGGCGGCAAAGATGGGGAGAATGGGAAGGAAGGGGGCGAGAAGAAGAACGGCAAGTACGAGAAGCCCCCCTTTTCCTACAATGCCCTGATCATGATGGCTATCCGCCAGAGCCCGGAGAAGCGCCTCACCCTCAATGGCATCTACGAGTTCATCATGAAGAACTTCCCCTACTACCGGGAGAACAAGCAGGGCTGGCAGAACTCCATCCGCCACAACCTCAGCCTCAACAAGTGCTTCGTCAAGGTGCCCCGCCACTACGATG
  5   1   2   14  bld Brn4 PIPE out                       CAAL20760.5p ...............................................CTTGTTGTGTTTATTTTGAAGGGACATGAAATAGTTTGCTGCATTCTCTCCCCTGGCTCGCACCCTGATTATATTTATATGTATATGTATTTACAGCCCTTTAATTGACGCCAATATTATGTGCGTTTGGTTTTTTGCTTCATGACTTACAAGTGTTTGGAGACGGTGGTGCGACAGAGCTGCTGCTGCGGCTGCTTCCTACTGCTGCGACTTGACTCGAGTGTCCGGCTCCAATCCTTGTGATATTTTGGACATGGGGGATAGGAAGGAAGTTAAAATGATCCCCAAGTCGTCGTTCAGTATCAACAGCCTAGTGCCTGAAGCCGTGCAAAATGACAACCATCCCCAGCCGCACCATCACCACCACCACCACCTGCAACTGCCGCAGCAGTCGCACCATCTGCAGCCCCACCACCGGCCGCTACAGGAGGAGGACGAGCTGGACAAGAGCCTCCTGGAAGTGAAGACAGAGAGCCTCCCCCCGGGTAAGGGAGACCCGGCTGCCTCCGAGCTGCCCGGGGAGGACAAGGAGAAGAGTGAGGACAAGAAGGCGGATGGTGGCGGCGGCAAAGATGGGGAGAATGGGAAGGAAGGGGGCGAGAAGAAGAACGGCAAGTACGAGAAGCCCCCCTTTTCCTACAATGCCCTGATCATGATGGCTATCCGCCAGAGCCCGGAGAAGCGCCTCACCCTCAATGGCATCTACGAGTTCATCATGAAGAACTTCCCCTACTACCG
  5   1   2       bld Gas8 5g                               st40d23.5p                                                                                                                   TTTATATGTATATGTATTTACAGCCCTTTAATTGACGCCAATATTATGTGCGTTTGGTTTTTTGCTTCATGACTTACAAGTGTTTGGAGACGGTGGTGCGACAGAGCTGCTGCTGCTGCTGCGGCTGCTTCCTACTGCTGCGACTTGACTCGAGTGTCCGGCTCCAATCCTTGTGATATGTTGGACATGGGGGATAGGAAGGAAGTTAAAATGATCCCCAAGTCGTCGTTCAGTATCAACAGCCTAGTGCCTGAAGCCGTGCAAAATGACAACCATCCCCAGCCGCACCATCACCACCACCACCACCTGCAACTGCCGCAGCAGTCGCACCATCTCCAGCCCCACCACCGGCCGCTACAGGAGGAGGACGAGCTGGACAAGAGCCTCCTGGAAGTGAAGACAGAGAGCCTCCCCCCGGGTAAGGGAGACCCGGCTGCCTCCGAGCTGCCCGGGGAGGACAAGGAGAAGAGTGAGGACAAGAAGGCGGATGGTGGCGGCGGCAAAGATGGGGAGAATGGGAAGGAAGGGGGCGAGAAGAAGAACGGCAAGTACGAGAAGCCCCCCTTTTCCTACAATGCCCTGATCATGATGGCTATCCGCCAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)