Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012090119 Xt7.1-CABM539.3 - 9 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                       Xt7.1-CABM539.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGATCCGGAATGTGCCCTGAAGGACGCAGAGACCTCTCTACAGATCGAAAAAGATTTCTTCAAGGGTCTTTACCAGAAGGCGGAGGCACTCTATTCTATGGGAGACTTTGAATTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGGCCAGAATTTCAGGGATTCCGCCTGGGGATTCAAAAGGCGCAGGAAGCAATAGAGAACTCTGTTGGAACTCCTGCCAGTGTTAAACTTCAAAATAAAGCAGACTTGCAGTTCATAAGCAGACAGGAGGAGAGCAAGAAAGCTAAGCAGAAGGCTCAGGTGAAGGTGCAGAAGAAGGATACAAAACAGCAGAAGAAAGTAGATCCTGAGAGGAGCCAGAAGACAGCGCGCCAGCTCCTCGGAGAGCTGTACAGTGATAAGGAGTATCTGGAATCATTATTAAGGGATGAAGCTTTAGTGAATGGAAACACACGGAGTGGGGTCAAACTGCATGACCTGATCATTAATGGAATCCTCTACCTGGACACCCGCACGGAGTTCTGGAGGCAGCAGAAGCCCATCTACGCGCGGGAGAGGGACCGCAAGATCATGCAGCAGAAGTGGAAGCGGGATAAAAACACGCCTGCCGACCCTAGCCAATACATTGTAAAGAGCCTGGAGGAAATAGATCAGCTGCTCTCAAGTGGAAAAGCAGAGGAAAGTTACAAAAAGGCCCAACTTGTGCTGAAGAAAGTCGAACGATGGACGTCGGTGGATGTGCACAACAGAGAAGAGCTCACTGGGAGTCTCCACAGCTGCATTGGGAATGCCCAGATGGACATGGGTCAGATAGAGGCAGCGCTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCCGGAGGCGAAATCCCGAGCTCTAGATAATATCGGGAGAGTTTACGCAAGAATTGGGAAATTCAGCGACGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAGTTCCAGCTTGGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCGAACGGCCGAAGCAAAGGATTATGGGGAAAAGTCGCAGCAGGAGGCTGATGCCGCTGAAGATATTGAGTGGCAGCTCAATGCTTGTGTGTTATTAGCACAGGCAGAAGTGAAGCTGAAGCATTACCAGTCGGCCATTACCAGTTTTGAAAATGCATTGGAGAGGGCAAGATTGCTTCACAATAAGGATGCAGAGCAAGCCATTCTCACGGCCTTGGAGGATGCAAGGCAGGGGCTAGAAGAGCAGCAGGAAGCAGACGACAGCGCTCATGAAAATGACAAATTAATGACAGAAGGGAACACAGCGAGTAAGGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGAAAGCTGAGGATATACCCATATATTTATACAGTATATATAAGTGGCGCAACATTCAGGCACATGAAATTGGGAACATTTTGCAGAAATAAAGTTAGCGGTTTCCGTAGGTCCTGGCCCAGAATATTGTTATTATTATCATATGTTTATAAAGCACCGACACATTCTGCAGCGTTACACAA
                                                  Xt7.1-CHK-1008237318                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGAATGTGCCCTGAAGGACGCAGAGACCTCTCTACAGATCGAAAAAGATTTCTTCAAGGGTCTTTACCAGAAGGCGGAGGCACTCTATTCTATGGGAGACTTTGAATTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGGCCAGAATTTCAGGGATTCCGCCTGGGGATTCAAAAGGCGCAGGAAGCAATAGAGAACTCTGTTGGAACTCCTGCCAGTGTTAAACTTCAAAATAAAGCAGACTTGCAGTTCATAAGCAGACAGGAGGAGAGCAAGAAAGCTAAGCAGAAGGCTCAGGTGAAGGTGCAGAAGAAGGATACAAAACAGCAGAAGAAAGTAGATCCTGAGAGGAGCCAGAAGACAGCGCGCCAGCTCCTCGGAGAGCTGTACAGTGATAAGGAGTATCTGGAATCATTATTAAGGGATGAAGCTTTAGTGAATGGAAACACACGGAGTGGGGTCAAACTGCATGACCTGATCATTAATGGAATCCTCTACCTGGACACCCGCACGGAGTTCTGGAGGCAGCAGAAGCCCATCTACGCGCGGGAGAGGGACCGCAAGATCATGCAGCAGAAGTGGAAGCGGGATAAAAACACGCCTGCCGACCCTAGCCAATACATTGTAAAGAGCCTGGAGGAAATAGATCAGCTGCTCTCAAGTGGAAAAGCAGAGGAAAGTTACAAAAAGGCCCAACTTGTGCTGAAGAAAGTCGAACGATGGACGTCGGTGGATGTGCACAACAGAGAAGAGCTCACTGGGAGTCTCCACAGCTGCATTGGGAATGCCCAGATGGACATGGGTCAGATAGAGGCAGCGCTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCCGGAGGCGAAATCCCGAGCTCTAGATAATATCGGGAGAGTTTACGCAAGAATTGGGAAATTCAGCGACGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAGTTCCAGCTTGGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCGAACGGCCGAAGCAAAGGATTATGGGGAAAAGTCGCAGCAGGAGGCTGATGCCGCTGAAGATATTGAGTGGCAGCTCAATGCTTGTGTGTTATTAGCACAGGCAGAAGTGAAGCTGAAGCATTACCAGTCGGCCATTACCAGTTTTGAAAATGCATTGGAGAGGGCAAGATTGCTTCACAATAAGGATGCAGAGCAAGCCATTCTCACGGCCTTGGAGGATGCAAGGCAGGGGCTAGAAGAGCAGCAGGAAGCAGACGACAGCGCTCATGAAAATGACAAATTAATGACAGAAGGGAACACAGCGAGTAAGGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGAAAGCTGAGGATATACCCATATATTTATACAGTATATATAAGTGGCGCAACATTCAGGCACATGAAATTGGGAACATTTTGCAGAAATAAAGTTAGCGGTTTCCGTAGGTCCTGGCCCAGAATATTGTTATTATTATCATATGTTTATAAAGCACCGACACATTCTGCAGCGTTACACAATAAATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     3     4     4     4     4     4     3     3     5     5     3     3     4     5     3     3     5     5     4     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     4     3     3     3     3
                                                                       ...PROTEIN --- Sc ---- 4e-008     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ---- 9e-008     XP_422185.2 PREDICTED: similar to G-protein signalling modulator 2 (AGS3-like, C. elegans) [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Mm ---- 1e-007     NP_077797.2 hypothetical protein LOC209683 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 4e-028     NP_611637.1 CG13502-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 9e-134     XP_786290.2 PREDICTED: similar to outer arm dynein binding protein [Strongylocentrotus purpuratus] -----------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 3e-137     NP_956610.1 hypothetical protein MGC56362 [Danio rerio] ---------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Hs ---- 1e-155     NP_113609.1 hypothetical protein LOC83538 [Homo sapiens] -----------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - ?? ---- 0          NP_001084612.1 hypothetical protein LOC414568 [Xenopus laevis] -----------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 0          AAH68935.1 LOC414568 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                       Xt7.1-CABM539.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TAA---------------------TGA---------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Te5       ?                          CAAO6478.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCTGAAGCGATCGGGAGTTTGAGGGCAGAACGATGGCTGAGGAGACAGAGGGGGAGCAGGCTCCCCAAAGTACATTCGCCACATACATGGCAGAGGGGGAACAGCTTTACCACAAAGCAGAATACAAGAAAGCCAAAGACAGTTTCACAGCAGCACTTCATCTGCAGCCTGAGGATAAGAACTGCCTCGTTGCTCGTTCCAAATGTTTCCTAAAACTTGGGATCCGGAATGTGCCCTGAAGGACGCAGAGACCTCTCTACAGATCGAAAAAGATTTCTTCAAGGGTCTTTACCAGAAGGCGGAGGCACTCTATTCTATGGGAGACTTTGAATTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGGCCAGAATTTCAGGGATTCCGCCTGGGGATTCAAAAGGCGCAGGAAGCAATAGAGAACTCTGTTGGAACTCCTGCCAGTGTTAAACTTCAAAATAAAGCAGACTTGCAGTTCATAAGCAGACAGGAGGAGAGCAAGAAAGCTAAGCAAAAAGCTCAGGTGAAGGTGCAGAAGAAGGATACAAAACAGCAGAAGAAAGTAGATCCTGAGAGGAGCCAGAAGACAGCGCGCCAGCTCCTCGGAGAGCTGTACAGTGATAAGGAGTATCTGGAATCATTATTAAGGGATGAAGCTTTAGTGAATGGAAACACACGGAGTGNGGTCAAACTGCATGACCTGATCATTAATGGAATCCTCTACCTGGACACCCGCAC
  5   1   2       bld Te6       in                          CABM539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGAGGGTTTCACAGCAGCACTTCATCTGCAGCCTGAGGATAAGAACTGCCTCGTTGCTCGTTCCAAATGTTTCCTAAAACTTGGGGATCCGGAATGTGCCCTGAAGGACGCAGAGACCTCTCTACAGATCGAAAAAGATTTCTTCAAGGGTCTTTACCAGAAGGCGGAGGCACTCTATTCTATGGGAGACTTTGAATTTGCCCTTGTGCATTACCACAGAGGGTACAAGCTGCGGCCAGAATTTCAGGGATTCCGCCTGGGGATTCAAAAGGCGCAGGAAGCAATAGAGAACTCTGTTGGAACTCCTGCCAGTGTTAAACTTCAAAATAAAGCAGACTTGCAGTTCATAAGCAGACAGGAGGAGAGCAAGAAAGCTAAGCAGAAGGCTCAGGTGAAGGTGCAGAAGAAGGATACAAAACAGCAGAAGAAAGTAGATCCTGAGAGGAGCCAGAAGACAGCGCGCCAGCTCCTCGGAGAGCTGTACAGTGATAAGGAGTATCTGGAATCATTATTAAGGGATGAAGCTTTAGTGAATGGAAACACACGGAGTGGGGTCAAACTGCATGACCTGATCATTAATGGAATCCTCTACCTGGACACCCGCACGGAGTTCTGGAGGCAGCAGAAGCCCATCTACGCGCGGGAGAGGGACCGCAAGATCATGCAGCAGAAGTGGAAGCGGGATAAAAACACGCCTGCCGACCCTAGCCAATACATTGTAAAGAGCCTGGAGGANATAGATCAGCTGCTCTCAAGTGGAAAAGCAGAGGAAAGTTACAAAAAGGCCCAACTTGTGCTGAAGAAAGTCGAACGATGGACGTCGGTGGATGTGCACAACAG
  5   1   2      seed Te5       in                         CAAO4560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACACACGGAGTGGGGTCAAACTGCATGACCTGATCATTAATGGAATCCTCTACCTGGACACCCGCACGGAGTTCTGGAGGCAGCAGAAGCCCATCTACGCGCGGGAGAGGGACCGCAAGATCATGCAGCAGAAGTGGAAGCGGGATAAAAACACGCCTGCCGACCCTAGCCAATACATTGTAAAGAGCCTGGAGGAAATAGATCAGCTGCTCTCAAGTGGAAAAGCAGAGGAAAGTTACAAAAAGGCCCAACTTGTGCTGAAGAAAGTCGAACGATGGACGTCGGTGGATGTGCACAACAGAGAAGAGCTCACTGGGAGTCTCCACAGCTGCATTGGGAATGCCCAGATGGACATGGGTCAGATAGAGGCAGCGCTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCCGGAGGCGAAATCCCGAGCTCTAGATAATATCGGGAGAGTTTACGCAAGAATTGGGAAATTCAGCGACGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAGTTCCAGCTTGGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCGAACGGCCGAAGCAAAGGATTATGGGGAAAAGTCGCAGCAGGAGGCTGATGCCGCTGAAGATATTGAGTGGCAGCTCAATGCTTGTGTGTTATTAGCACAGGCAGAAGTGAAGCTGAAGCATTACCAGTCGGCCATTACCAGTTTTGAAAATGCATTGGAGAGGGCAAGATTGCTTCACAATAAGGATGCAG
  5   1   2       bld Te3  PIPE in                        CAAM16202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGCACGGAGTTCTGGAGGCAGCAGAAGCCCATCTACGCGCGGGAGAGGGACCGCAAGATCATGCAGCAGAAGTGGAAGCGGGATAAAAACACGCCTGCCGACCCTAGCCAATACATTGTAAAGAGCCTGGAGGAAATAGATCAGCTGCTCTCAAGTGGAAAAGCAGAGGAAAGTTACAAAAAGGCCCAACTTGTGCTGAAGAAAGTCGAACGATGGACGTCGGTGGATGTGCACAACAGAGAAGAGCTCACTGGGAGTCTCCACAGCTGCATTGGGAATGCCCAGATGGACATGGGTCAGATAGAGGCAGCGCTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCCGGAGGCGAAATCCCGAGCTCTAGATAATATCGGGAGAGTTTACGCAAGAATTGGGAAATTCAGCGACGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAGTTCCAGCTTGGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCGAACGGCCGAAGCAAAGGATTATGGGGAAAAGTCGCAGCAGGAGGCTGATGCCGCTGAAGATATTGAGTGGCAGCTCAATGCTTGTGTGTTATTAGCACAGGCAGAAGTGAAGCTGAAGCATTACCAGTCGGCCATTACCAGTTTTGAAAATGCATTGGAGAGGGCAAGATTGCTTCACAATAAGGATGCAGAGCAAGCCATTCTCACGGCCTTGGAGGATGCAAGGCAGGGGCTAGAAGAGCAGCAGGAAGCAGACGACAGCGCTCATNGAAATGACAAATTAATGACAGAAGGGAACACAGCGAGTAAGGAGGAGGATGTGCATGCAGAAAG
  3   1   2       bld Te6       in                          CABM539.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAGCTGCATTGGGAATGCCCCAGATGGACATGGGTCAGATAGAGGCAGCGCTGCAGAGCCACAAGAAGGACTTGGCTATAGCAGAGAAATACAAATTGCCGGAGGCGAAATCCCGAGCTCTAGATAATATCGGGAGAGTTTACGCAAGAATTGGGAAATTCAGCGACGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAGTTCCAGCTTGGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCGAACGGCCGAAGCAAAGGATTATGGGGAAAAGTCGCAGCAGGAGGCTGATGCCGCTGAAGATATTGAGTGGCAGCTCAATGCTTGTGTGTTATTAGCACAGGCAGAAGTGAAGCTGAAGCATTACCAGTCGGCCATTACCAGTTTTGAAAATGCATTGGAGAGGGCAAGATTGCTTCACAATAAGGATGCAGAGCAAGCCATTCTCACGGCCTTGGAGGATGCAAGGCAGGGGCTAGAAGAGCAGCAGGAAGCAGACGACAGCGCTCATGAAAATGACAAATTAATGACAGAAGGGAACACAGCGAGTAAGGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAGCAGCAAGGAGGATGAAAGCTGAGGATATACCCATATATTTATACAGTATATATAAGTGGCGCAACATTCAGGCACATGAAATTGGGAACATTTTGCAGAAATAAAGTTAGCGGTTTCCGT
  3   1   2       bld Te5       in                         CAAO4560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATCCCGAGCTCTAGATAATATCGGGAGAGTTTACGCAAGAATTGGGAAATTCAGCGACGCCATCAAGGTATGGGAAGAGAAGATCCCTCTGGCCAGTTCCAGCTTGGAAAAGACCTGGTTGTATCATGAGATTGGGAGATGTTACCTGGAGCTGGAGCGAACGGCCGAAGCAAAGGATTATGGGGAAAAGTCGCAGCAGGAGGCTGATGCCGCTGAAGATATTGAGTGGCAGCTCAATGCTTGTGTGTTATTAGCACAGGCAGAAGTGAAGCTGAAGCATTACCAGTCGGCCATTACCAGTTTTGAAAATGCATTGGAGAGGGCAAGATTGCTTCACAATAAGGATGCAGAGCAAGCCATTCTCACGGCCTTGGAGGATGCAAGGCAGGGGCTAGAAGAGCAGCAGGAAGCAGACGACAGCGCTCATGAAAATGACAAATTAATGACAGAAGGGAACTCAGCGAGTAAGGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAGCAGCAAGGAGGATGAAAGCTGAGGATATACCCATATATTTATACAGTATATATAAGTGGCGCAACATTCAGGCACATGAAATTGGGAACATTTTGCAGAAATAAAGTTAGCGGTTTCCGTAGGTCCTGGCCCAGAATATTGttattattatcatatgtttataaagcaccgacacattctgcagcgttacacaataaatgggcgtatacaTTT
  3   1   2       bld Te3  PIPE in                        CAAM16202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGAGTGGCAGCTCAATGCTTGTGTGTTTTTAGCCCCGGCAGAAGTGAAGCTGAAGCTTTCCCAGTCGGCCTTTCCCAGTTTTGAAAATCCTTTGGGGGGGGCAAGATTTTTTCCCAATAAGGATGCGGAGCAAGCCTTTTTCCCGGCCTTGGGGGATCCAAGGCAGGGGCTAGAAGACCACCAGGAAGCAGACGCCAGCCCTCTTGAAAATGCCAATTTAATGCCAGAAGGGACCCCCCCGGGTAAGGGGGGGGATGTCCTTCCAGAAAGCAGCGGGGGGGATGTCCTTCCAGAAAACAGCGGGGGGGATGTCCCTCCAGAAAGCAGCGAGGGGGATGTCCCTCCAGAAAACCGCGGGGGGGATGTCCCTCCAGAAACCAGCGGGGGGGATGTGCCTCCAGAAACCCCCAAGGGGGATGAAAGCTGGGGATATCCCCCTTTTTTTTTCCCGTATTTTTAAGGGGGG
  3   1   0       add Te5       in                         CAAO3013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAGCAGCAAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGAAAGCTGAGGATATACCCATATATTTATACAGTATATATAAGTGGCGCAACATTCAGGCACATGAAATTGGGAACATTTTGCAGAAATAAAGTTAGCGGTTTCCGTAGGTCCTGGCCCAGAATATTGTTATTATTATCATATGTTTATAAAGCACCGACACATTCTGCAGCGTTACACAATAAATGGGCATATACGTT
  5   1   0       add Te5       in                         CAAO3013.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAAAACAGCGAGGAGGATGTGCATGCAGAAAGCAGCGAGGAGGATGTGCATGCAGAAAGCAGCAAGGAGGATGTGCATGCAGAAAACAGCGAGGAGGATGAAAGCTGAGGATATACCCATATATTTATACAGTATATATAAGTGGCGCAACATTCAGGCACATGAAATTGGGAACATTTTGCAGAAATAAAGTTAGCGGTTTCCGTAGGTCCTGGCCCAGAATATTGTTATTATTATCATATGTTTATAAAGCACCGACACATTCTGCAGCGTTACACAATAAATGGGCATATACGTTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)