Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas143j06.3                          7 END     1           9       16                odd-skipped related 1 (Drosophila) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012090204 Xt7.1-CABJ8826.3 - 11 ESTs
                                                                       .......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ8826.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCCAGAGGGGCAAATTTTAGGAGGAGGGGGCAATAAATAATTTTGCCCTTTCTAGTTACATCACTGTGTTCTCCCAAACTCCATTCCAGTATAGGTACTGTCAGGCTCTGTCATTACTATTGCCTATTGATATGGGCCCTTGGCATTTGTCTGAGAGCAGAGTATTGGCTACCAAATGTGCCAGGGCATGGCTGAGTTTCCATACAGAATATTAAGCCGATAAGGCACAGCTCTGCAAGGCTTCCTTAATACAGGGTAAAACTTGCTAAACTCCCAAGGAATCACCCCATTCTAGGTGCCACATTAGCCCCATTGGGCAGCCCAGCAGAAGGGAACCACACATGAGGTGTGCAAAAAGGGTGAAAATTTCATAAATTACTATTTTAAAAAAAATTATTTTTGTATACATAGGCATAATTAAGGGGTTAAACTGCCCTTTTTAGAATCTATTTCTGGGTATCAGGGGGGAACAAGACGCAGGTAGTTGGTACTATACAGGGCCCAGTGGCTGCGGTGCTCTCATCCGTCAGTAATTCATTTGCAAAGGTTTTGTAAATACCGACTTCCGTTCAGTTGAACGTTTTTATTCATTCTATCTATGCATTACTGGCATCTATGCAGCCCCTTAAACAATAAACCAAAGTCTTCCAGAAGCCCATGGATTCTGCTTCCTATGTTGCTTCTCACGAGGTGCAATGCACTAATTGCCTTGGGTGTAATGGGAATGGAACTCTGGGGTAAAAAAAACTGAATTTTGGCAAAATAACAAGGTAACGTGCCAGCAATCACTTTGCCTTCGGCAGCCTTTAATAAATGAACTGAGATATTAAACTCACCAATTAGGGACCACTGCACAGCAGCCAATGTACGATTGTCTTTCATTGCACACCTTGATTTAATCTGAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAATGCAGGAAGGCTGAGGCAGGCATGAGTTAGGGGAGAGGGGCCCCTTGCAATGCAGGAAGGCTGACATCTAGGGTTGGAAAATCAGCTGTGGCTAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATCTGCAAATATCTAACCATAAAATGTCCTTTATTCTCTTATCTGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCACAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCCTTAGATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAAAGGAAATATGAAT
                                                  Xt7.1-CHK-1008234966                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGGGCAAATTTTAGGAGGAGGGGGCAATAAATAATTTTGCCCTTTCTAGTTACATCACTGTGTTCTCCCAAACTCCATTCCAGTATAGGTACTGTCAGGCTCTGTCATTACTATTGCCTATTGATATGGGCCCTTGGCATTTGTCTGAGAGCAGAGTATTGGCTACCAAATGTGCCAGGGCATGGCTGAGTTTCCATACAGAATATTAAGCCGATAAGGCACAGCTCTGCAAGGCTTCCTTAATACAGGGTAAAACTTGCTAAACTCCCAAGGAATCACCCCATTCTAGGTGCCACATTAGCCCCATTGGGCAGCCCAGCAGAAGGGAACCACACATGAGGTGTGCAAAAAGGGTGAAAATTTCATAAATTACTATTTTAAAAAAAATTATTTTTGTATACATAGGCATAATTAAGGGGTTAAACTGCCCTTTTTAGAATCTATTTCTGGGTATCAGGGGGGAACAAGACGCAGGTAGTTGGTACTATACAGGGCCCAGTGGCTGCGGTGCTCTCATCCGTCAGTAATTCATTTGCAAAGGTTTTGTAAATACCGACTTCCGTTCAGTTGAACGTTTTTATTCATTCTATCTATGCATTACTGGCATCTATGCAGCCCCTTAAACAATAAACCAAAGTCTTCCAGAAGCCCATGGATTCTGCTTCCTATGTTGCTTCTCACGAGGTGCAATGCACTAATTGCCTTGGGTGTAATGGGAATGGAACTCTGGGGTAAAAAAAACTGAATTTTGGCAAAATAACAAGGTAACGTGCCAGCAATCACTTTGCCTTCGGCAGCCTTTAATAAATGAACTGAGATATTAAACTCACCAATTAGGGACCACTGCACAGCAGCCAATGTACGATTGTCTTTCATTGCACACCTTGATTTAATCTGAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAATGCAGGAAGGCTGAGGCAGGCATGAGTTAGGGGAGAGGGGCCCCTTGCAATGCAGGAAGGCTGACATCTAGGGTTGGAAAATCAGCTGTGGCTAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATCTGCAAATATCTAACCATAAAATGTCCTTTATTCTCTTATCTGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCACAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCCTTAGATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAAAGGAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     7     7     7     7     7     7     7     7     5     7     7     7     7     7     5     7     7     7     7     7     7     7     7     7     7     7     7     7     5     7     7     7     6     7     7     7     7     7     6     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     6     3     6     4     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                      Xt7.1-CABJ8826.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAA---------------------------------------------------TAA------------------------------------------------------------------------ATG---------------------------TAA------------------------------------------------------------------TAG---------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------TAA------------------------------------------------------------------ATG---TAA------------TAA------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG------------------------------TAA---------------------------------------------------------------ATG---TAG------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------TAA---------TAG------------------------------------TAAATG---------------TAG---------ATG---------------------------------------------------------------------TAA------TGA------------TAA------------ATG------------------------------------------------------ATG------------TAA------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                               ]
  5   1   2       bld Tad5      in                         XZT53620.5p CAGCAGTGCCAATTATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGTGCCAGTAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGTGCCAATTATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGGGCAATAATAGCCTTGGGTAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCGGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGGGCAATACAGAGACAGTGGGGCAATAACTCTTTACATCTGTGCTCTGCTTGGGCGTTACTATAGCAGATCCAGGGGGAAGAGGGGGCCCAGAGGGGCAAATTTTAGGAGGAGGGGGCAATAAATAATTTTGCCCTTTCTAGTTACATCACTGTGTTCTCCCAAACTCCATTCCAGTATAGGTACTGTCAGGCTCTGTCATTACTATTGCCTATTGATATGGGCCCTTGGCATTTGTCTGAGAGCAGAGTATTGGCTACCAAATGTGCCAGGGCATGGCTGAGTTTCCATACAGAATATTAAGCCGATAAGGCACAGCTCTGCAAGGCTTCCTTAATACAGGGTAAAACTTGCTAAACT
  5   1   2       bld Gas7      in                         XZG46944.5p                                                                                                                                                                                                          GGGACAGCAGGTCTAGCAGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGGGCAATAATAGCCTTGGGTAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCGGTGCCAATAATAGCCTTGGATAAAGTGCATGTATCTGTGGGACAGCAGGTATAGCAGGGCAATACAGAGACAGTGGGGCAATAACTCTTTACATCTGTGCTCTGCTTGGGCGTTACTATAGCAGATCCAGGGGGAAGAGGGGGCCCAGAGGGGCCCAGAGGGGCAAATTTTAGGAGGAGGGGGCAATAAATAATTTTGCCCTTTCTAGTTACATCACTGTGTTCTCCCAAACTCCATTCCAGTATAGGTACTGTCAGGCTCTGTCATTACTATTGCCTATTGATATGGGCCCTTGGCATTTGTCTGAGAGCAGAGTATTGGCTACCAAATGTGCCAGGGCATGGCTGAGTTTCCATACAGAATATTAAGCCGATAAGGCACAGCTCTGCAAGGCTTCCTTAATACAGGGTAAAACTTGCTAAACTCCCAAGGAATCACCCCATTCTAGGTGCCACATTAGCCCCATTGNGCAGCACAGCAGAAGGGAACCACACATGAGGTGTGCAAAAAGGGTGAAAATTTCATAAATTACTATTTTAAAAAAAATTATTTTTGTATACATAGGCAT
  3   1   2       bld Gas7      in                         XZG46944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCCTTTCTAGTTACATCACTGTGTTCTCCCAAACTCCATTCCAGTATAGGTACTGTCAGGCTCTGTCATTACTATTGCCTATTGATATGGGCCCTTGGCATTTGTCTGAGAGCAGAGTATTGGCTACCAAATGTGCCAGGGCATGGCTGAGTTTCCATACAGAATATTAAGCCGATAAGGCACAGCTCTGCAAGGCTTCCTTAATACAGGGTAAAACTTGCTAAACTCCCAAGGAATCACCCCATTTTAGGTGCCACATTAGCCCCATTGGGCAGCCCAGCAGAAGGGAACCCCCCCTGAGGTGTGCAAAAAGGGTGAAAATTTCATAAATTACTATTTTAAAAAAAATTATTTTTGTATACATAGGCATAATTAAGGGGTTAAACTGCCCTTTTTAGAATCTATTTCTGGGTATCAGGGGGGAACAAGACGCAGGTAGTTGGTACTATACAGGGCCCAGTGGCTGCGGTGCTCTCATCCGTCAGTAATTCATTTGCAAAGGTTTTGTAAATACCGACTTCCGTTCAGTTGAACGTTTTTATTCATTCTATCTATGCATTACTGGCATCTATGCAGCCCCTTAAACAATAAACCAAAGTCTTCCGG
  5   1   2      skin TbA       in                   TTbA010n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCCTTGGCATTTGTCTGAGAGCAGAGTATTGGCTACCAAATGTGCCAGGGCATGGCTGAGTTTCCATACAGAATATTAAGCCGATAAGGCACAGCTCTGCAAGGCTTCCTTAATACAGGGTAAAACTTGCTAAACTCCCAAGGAATCACCCCATTCTAGGTGCCACATTAGCCCCATTGGGCAGCACAACAGAAGGGAACCACACATGAGGTGTGCAAAAAGGGTGAAAATTTCATAAATTACTATTTTAAAAAAAATTATTTTTGTATACATAGGCATAATTAAGGGGTTAAACTGCCCTTTTTAGAATCTATTTCTGGGTATCAGGGGGGAACAAGACGCAGGTAGTTGGTACTATACAGGGCCCAGTGGCTGCGGTGCTCTCATCCGTCAGTAATTCATTTGCAAAGGTTTTGTAAATACCGACTTCCGTTCAGTTGAACGTTTTTATTCATTCTATCTATGCATTACTGGCATCTATGCAGCCCCTTAAACAATAAACCAAAGTCTTCCAGAAGCCCATGGATTCTGCTTCCTATGTTGCTTCTCACGAGGTGCAATGCACTAATTGCCTTGGGTGTAATGGGAATGGAACTCTGGGGTAAAAAAAAACTGAATTTTGGCAAAATAACAAGGTAACGTGCCAGCAATCACTTTGCCTTCGGCAGCCTTTAATAAATGAACTGAGATATTAAACTCACCAATTAGGGACCACTGCACAGCAGCCAATGTACGATTGTCTTTCATTGCACACCTTGATTTAATCTGAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAT
  5   1   2      seed Ski1      in                         CABJ8826.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGACGCAGGTAGTTGGTACTATACAGGGCCCAGTGGCTGCGGTGCTCTCATCCGTCAGTAATTCATTTGCAAAGGTTTTGTAAATACCGACTTCCGTTCAGTTGAACGTTTTTATTCATTCTATCTATGCATTACTGGCATCTATGCAGCCCCTTAAACAATAAACCAAAGTCTTCCAGAAGCCCATGGATTCTGCTTCCTATGTTGCTTCTCACGAGGTGCAATGCACTAATTGCCTTGGGTGTAATGGGAATGGAACTCTGGGGTAAAAAAAACTGAATTTTGGCAAAATAACAAGGTAACGTGCCAGCAATCACTTTGCCTTCGGCAGCCTTTAATAAATGAACTGAGATATTAAACTCACCAATTAGGGACCACTGCACAGCAGCCAATGTACGATTGTCTTTCATTGCACACCTTGATTTAATCTGAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAATGCAGGAAGGCTGAGGCAGGCATGAGTTAGGGGAGAGGGGCCCCTTGCAATGCAGGAAGGCTGACATCTAGGGTTGGAAAATCAGCTGTGGCTAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATCTGCAAATATCTAACCATAAAATGTCCTTTATTCTCTTATCTGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCACAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCC
  3   1   2       bld Ski1      in                         CABJ8826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGCCTTTAATAAATGAACTGAGATATTAAACTCACCAATTAGGGACCACTGCACAGCAGCCAATGTACGATTGTCTTTCATTGCACACCTTGATTTAATCTGAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAATGCAGGAAGGCTGAGGCAGGCATGAGTTAGGGGAGAGGGGCCCCTTGCAATGCAGGAAGGCTGACATCTAGGGTTGGAAAATCAGCTGTGGCTAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATCTGCAAATATCTAACCATAAAATGTCCTTTATTCTCTTATCTGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCACAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCCTTAGATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTTAAAACATTTATCACTGGATTGTAAAATAAAGGAAATATGAATCGAGAAAAAAA
  5   1   2       bld Tad5      in                         XZT50209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCACTGCACAGCAGCCAATGTACGATTGTCTTTCATTGCACACCTTGATTTAATCTGAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAATGCAGGAAGGCTGAGGCAGGCATGAGTTAGGGGAGAGGGGCCCCTTGCAATGCAGGAAGGCTGACATCTAGGGTTGGAAAATCAGCTGTGGCTAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATCTGCAAATATCTAACCATAAAATGTCCTTTATTCTCTTATCTGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCACAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAAAGGAAATATTGAAT
  3   1   2       bld Tad5      in                         XZT53620.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAGGGGATTGGCTGTACTACTTGTGGGCCCCTTGCAATGCAGGAAGGCTGAGGCAGGCATGAGTTAGGGGAGAGGGGCCCCTTGCAATGCAGGAAGGCTGACATTTAGGGTTGGAAAATCAGCTGTGGCTAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATTTGCAAATATTTAACCATAAAATGTCCTTTATTCTCTTATCGGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCACAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCCTTAGATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAAAGGAAATATTGAATCGAAAAAAAAAAAAAAAGG
  3   1   2       bld TbA       in                   TTbA010n05.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAGGGGCCCCTTGCAATGCAGGAAGGGTGACATTTAGGGTTGGAAAATCAGCTGTGGGTAAAATACAGGTCCCATCATGCCCTTGGGCCTACAGTTTAACAATAGGTACCCCTCTTTTTTTGCAAATATTTAACCATAAAAAGTCCCTTATTTTTTTATCTGTCTCCCCCCCTAAGAAGGGGACTATGGTACCTCCTACTAGGGGCCAGATGTTCCCCCGAACGACCAAATGTTCCCTTTTTGCCCAGGTAACAGTTCAACCCCTTTTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCCTTAGATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGGTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATTTATTTTTTAAAGCAGGTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAA
  3   1   2       bld Tad5      in                         XZT50209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCTTTTGCAAATATTTAACCATAAAATGTCCTTTATTTTCTTATCGGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTTTTAGCCCAGGTAACAGTTCAACCCATTTTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAAAGGAAATATTGAATCG
  3   1   2       bld Hrt1      out                        CAAQ7746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTACAGCTCCCATCATGCCCTTGGACCTACAGTTTAACAATAGCTACCCATCATCATTTGCAAATATCTAACCATAAAATGTCCTTTATTCTCTTATCGGTCTCCTCCCCTAAGAAGCTGACTATGGTACCTCCTACTAGGAGCCAGATGTCCCCCAGAACGACCAAATGTCCCCTATTAGCCCAGGTAACAGTTCAACCCATATTGAACCCAATTCCCATATTTCAGTTTACCCCCCCCCCCCCCCTTAGATTAAGATAAGAGGAGCTGTAGGAAGGGGCCCATTCCCCAACAGCTCATACCCATGTGTAAATGCTCCGGCTGATTATTTAGCTCAGTAACATGCATGCTGGTTTAAGTGGGGTTAATACGTGCAGTTCAACCCAACCGTTGAAATTATCCTATCTATTTTTTTAAAGCAGCTGACATTCCGAAAATTAAAAAATAAAAAAAATGTCTATATATATATATAAATATATTGTACAGATTTGTATAGTTGTTTGGCACTTTATGCTGATTGATGGTTAAAAACATTTATCACTGGATTGTAAAATAAAGGAAATATGAATCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)