Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT52588.3                            6 END     4          80       66                Ce1-A protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 91%

 1012090460 Xt7.1-XZT61941.5 - 5 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT61941.5                     CTGATGGTCAGAGCTGCTGTCCGTGCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAACACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATACTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGNGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAATAAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGTTGACACAGGCACTTCTTT
                                                  Xt7.1-CHK-1008243529                           GTCAGAGCTGCTGTCCGTGCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAACACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATACTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGNGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAATAAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGTTGACACAGGCAC
                                                      consensus depths                          2     2     2     2     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3
                                               BLH ATG      31     185                     
                                               BLH MIN      22     106                     
                                               BLH OVR      31     218                     
                                               ORF LNG      31      11                     
                                                                                                                          PREDICTED = Sp ==== 9e-038     XP_001188302.1 PREDICTED: similar to cathepsin D1, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 3e-051     NP_015171.1 vacuolar proteinase A; Pep4p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN === Ce ==== 8e-064     NP_510191.1 aspartic protease (49.3 kD) (asp-4) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN === Dm ==== 4e-068     NP_652013.1 CG1548-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PROTEIN --- Dr ---- 1e-070     NP_956325.1 Unknown (protein for MGC:63831) [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PROTEIN === Xt ==== 2e-074     AAH88066.1 LOC496914 protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Mm ---- 9e-104     NP_031825.1 cathepsin E preproprotein [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PREDICTED - Gg ==== 5e-106     XP_001235024.1 PREDICTED: similar to cathepsin E [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PROTEIN -== Hs ==== 2e-111     NP_001901.1 cathepsin E isoform a preproprotein [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN === Xl ==== 6e-152     BAC57453.1 cathepsin E1 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN === ?? ==== 6e-152     NP_001079043.1 cathepsin E1 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT61941.5                      TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------ATG------------ATG
                                                                   ORF                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  0   1   1           HeRe FL                   EC2CAA32DE05.FL-Pollet               gagacactgatggtcagagctgctgtccgtgcaaaggatgagacaaatacttttactcttgctattcgcgacccttgTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAGCACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATGCTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGGGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAATAAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGTTGACACAGGCACTTCTTTGATCACCGGTCCCTCTTCTGATATTGTTCAGCTTCAAAGCATAATTGGAGCATCTGCTGCAAATGGAGATTATGAAGTGGATTGCAGTGTTCTGAATGAAATGCCAACAGTGACTTTTACTATTTTACACATTTGCTGTGAGTCTTGGGAGGTGCAAGTAACACTTCTACCTCCGTATTCATGAAAAAAGCCTTTCAAATTACATTAAATGAGGTTATGCAAATTTAATAATGTCTAGTTGTTAGAACTTGCAGTTtaatataatggtattctagattagtctaggttagtctttgaattatttttattttgaaaaagacaaataaaaagatcccc
  0   1   1           Tad5 FLq                         XZT52588.FL-MGC                                            GCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAACACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATACTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGGGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAATAAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGTTGACACAGGCACTTCTTTGATCACCGGTCCCTCTTCTGATATTGTTCAGCTTCAAAGCATAATTGGAGCATCTGCTGCAAATGGAGATTATGAAGTGGATTGCAGTGTTCTGAATGAAATGCCAACAGTGACTTTTACTATTAATGGAATTGGGTACCAGATGACACCACAACAATATACTCTACAAGATGGTGGTGGCATCTGCAGCAGCGGCTTCCAAGGTCTCGATATTTCTCCCCCTGCTGGACCTCTCTGGATCCTAGGAGATGTTTTTATCGGCCAATATTACTCTGTATTTGATAGGGGTAATAACAGAGTGGGACTTGCCCCAGTAGTACCTTATCCACCACTTAAGAATGGTGTGTGATTATCTCAATTAAGCTTTTAGCATGTTTTAAAAGCCAAAGCTAATTTGAGTTCTGGCTTATCTAATTTATCTCTGCTTCCTCCATTTTACATGTAAATCCCTGTTCCATGCCAGCTCCAAGGTAGGTAGGTGGGGGGGCACGTCAGGGCAGGGGGCGCTGGGCCCTTTTAAAGATTTGTTTGCAGGGAGGTCCAGTGTACGCCACTGCTATGTAATACACCCTAGCTTTGCACTTACCTCTGTTACCTCTGTTTTCCTTCTAACAGATATATTACATAAGGTACTATTTTACACATTTGCTGTGAGTCTTGGGAGGTGCAAGTAACACTTCTACCTCCGTACTCATGAAAAAAGCCTTTCAAATTACATGAAATGAGGTTATGCAAATTTACTAATGTCTAGTTGTTAGAACTTGCAGTTTAATATAATCGTATTCTAGATTAGTCTAGGTTAGTCTTTGAATTATTTTTATTTTTGAAAAATGACAAATAAAAAAAAACTTCCTGAAAAAAAAAAAAAAAA
  5   1   2      seed HeRe FL                          EC2CAA32DE05.g1               GAGACACTGATGGTCAGAGCTGCTGTCCGTGCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAGCACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATGCTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTG
  5   1   2   12  bld Tad5 PIPE out                        XZT66592.5p ....................CTGATGGTCAGAGCTGCTGTCCGTGCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAGCACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATGCTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGNGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAAATAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGNTGACACAGGCACTTCTTTGAT
  5   1   2   12  bld Tad5 5g3  out                        XZT61941.5p ...................................GCTGTCCGTGCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAACACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATACTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGGGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGNGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAATAAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGTTGACACAGGCACTTTCTTGATCACCGNTCCCTCTTCTGATNATGTTCAGCTTCAAAGCATAATTGGAGCATCTGCTGC
  5   1   2   13  bld Tad5 FLq  out                        XZT52588.5p ...........................................GCAAAGGATGAGACAAATACTTTTACTCTTGCTATTCGCGACCCTTGTTTATGGGTTAATAAGGGTTCCCCTGAAGAGACAGAAGTCCATTCGAAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGTATGGACTCAGCAGGGAATAGACATGATTCAGTACACCGATTCCTGCAGCAATAACCAGGCCCCCAGTGAGCCCCTGATTAACTACATGGATGTGGAATACTTTGGCGAGATCTCTATTGGCACTCCTCCTCAGAACTTCACTGTGATTTTTGACACTGGCTCTTCAAATTTGTGGGTTCCATCTGTGTACTGCATAAGCCCAGCCTGTGCTCAGCACAACAGGTTTCAGCCTCAGTTCTCAAACACCTATCAATCAAATGGAAATAATTTCTCCCTTCAGTATGGAACTGGTAGTCTCTCAGGCATCATAGGAACTGACTCTGTTTCTGTAGAAGGTATCTTGGTGCAGAGCCAGCAATTTGGGGAGAGTGTGTCTGAGCCAGGCAGTACTTTTGTTGATACTGAATTTGATGGCATACTGGGTCTGGGATATCCTTCTATTGCAGTAGGGGACTGTACACCTGTATTTGATAACATGATGACTCAGAATCTGGTGGAATTGCCAATGTTTTCTGTCTATATGAGCAGAAATCCAAATTCCCCAGTAGGAGGGGAGCTGGTGTTTGGNGGGTTTGATGCATCTCGCTTCTCTGGCCAGTTAAATTGGGTGTCTGTTACTAACCAAGGCTACTGGCAAATACAGCTGGATAACATCCAAATAAATGGTGAGGTGGTATTCTGCACTGGTGGATGTCAGGCTATTGTTGACACAGGCACTTCTTTG
  5   1   2       bld Gas1      out                    NISC_mq25h01.y1                                                                                                                        GAGACAGAAGTGCATTCGAAAAAAACTGAAGGAGAAAGGGAAGCTTTCCCACGGATGGACTCAAGAGGGAATAGACATGATTCAGGACACCGATTCCTGAAGCAATAACCAGAGCCCCAATGAGCCCCTGATTAACTACATGGATGTGGAATACATTTGGAGAGATCTCTATTGGAACTCCTCCTCAAAACTTCACTGTGATTTTTGACACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)