Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012090477 Xt7.1-XZG33177.3 - 9 ESTs
                                                                       ......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG33177.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGGTGAGTGGGTAAGGCTGGGGCACCGGGTTATATAGAGGGGCCAGTACACCTGTCATTCATTATAAAGATTATAGGGGGATAGAGTGTAGTAAATCAATTCTAGAATGGAACTGAATGGACCCCCAGTTTCCCAGCTTCCTCAGACCGCAACTTCTACCGCATCACTTCCAGTCACAGTGGCCGGTACTCTCCTACGAGGCCCCCAGCTGCTGCTCCGAGCCGCAGAGAAGTATCCCCGTACCCCCAAGTGCGCCCGCTGCAGGAATCACGGGGTAGTGTCTGCGCTCAAGGGCCACAAGCGCTACTGCCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGATCGCGGAGCGCCAGAGGGTTATGGCCGCGCAAGTTGCGCTACGCAGGCAGCAAGCCCAGGAGGAGAATGAGGCCCGAGAGCTGCAGCTTCTCTATGGAACTGCTGAAGGATTGGCACTGGCGGCAGCCAATGGCATCATCCCACCCCGGCCAGCCTACGAGGTCTTCGGATCGGTGTGTACAGAGGGAGGAACAGATTCAAAGATTCAGAAGTTCGACTTGTTCCCTAAAAGCCTCATCCCCAGATCTGTGACTCCTCAACTGTCTTCTGGGGGAAAACCAGTGTCCCCAGACAGTGAATCGGTGTCAGGCAGTGCACCAGGTGCCTCATCCCCTGAAGCACGGCCTGGTTCTGGCTCGGAAAATGGGGATGGGGAGTCCTTGCTCAGTTCCCCCATCTCTAAGGCACTCAAAGAAGGAGAGGAGAGCCCAAGCTCAATTAGCCCCCTGGGCTCAGAATCTGGATCTGATGCTGAAAAAGATGAGCAGGATCCCAGTTCTTCCTCCTCAGCCAGGCAGAGGACCCCCATAGACATCCTGACCAGGGTCTTCCCTGCTCAGAAGAGGAGCGTTCTGGAACTGGTGCTGCAGGGCTGTGGGGGAGATGTGGTTCAAGCAATTGAACAGATACTAAACAACAGGGGACAGGATAAGAGTGAAGAGACCTGGTCAAGAGATGGAGCCCTCCCAAGTATTCAGCCATCAGTGTCCTCCACACACAGACCCCTTATTGCTGGAGCCCTTACTCCTGCTATTGGCACATTAGGGAGCAGGTCTGCATTCTCCCCTTTACAACCCAATGGCGCACACTTTGGCACTGAGGCGCATGCGCATCCCATCTGGGTGGGCACCTTGGGTTAAACCCACTGAGGTTAGCCTATTCTGCGCACAGTAGAGGACTTGCTTTCATGGCCCCTTACTCAACAGCTGGTTTCATGCCTACCCTTGGGTTTCGCCCACCCATGGACTACGCCTTCAGTGACCTTATGAGGGACAGGGCCAATGTTCACAAGGACCAGGTATACACTAATGGACTCTATGGGCCAGTGGTCAATAATAATGCTGAAAAACAATGAATTCTTTATATAAGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGACCGTTCCCTAAGCATTAGAAATAAATGTTAT
                                                  Xt7.1-CHK-1008237369                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTGGGTAAGGCTGGGGCACCGGGTTATATAGAGGGGCCAGTACACCTGTCATTCATTATAAAGATTATAGGGGGATAGAGTGTAGTAAATCAATTCTAGAATGGAACTGAATGGACCCCCAGTTTCCCAGCTTCCTCAGACCGCAACTTCTACCGCATCACTTCCAGTCACAGTGGCCGGTACTCTCCTACGAGGCCCCCAGCTGCTGCTCCGAGCCGCAGAGAAGTATCCCCGTACCCCCAAGTGCGCCCGCTGCAGGAATCACGGGGTAGTGTCTGCGCTCAAGGGCCACAAGCGCTACTGCCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGATCGCGGAGCGCCAGAGGGTTATGGCCGCGCAAGTTGCGCTACGCAGGCAGCAAGCCCAGGAGGAGAATGAGGCCCGAGAGCTGCAGCTTCTCTATGGAACTGCTGAAGGATTGGCACTGGCGGCAGCCAATGGCATCATCCCACCCCGGCCAGCCTACGAGGTCTTCGGATCGGTGTGTACAGAGGGAGGAACAGATTCAAAGATTCAGAAGTTCGACTTGTTCCCTAAAAGCCTCATCCCCAGATCTGTGACTCCTCAACTGTCTTCTGGGGGAAAACCAGTGTCCCCAGACAGTGAATCGGTGTCAGGCAGTGCACCAGGTGCCTCATCCCCTGAAGCACGGCCTGGTTCTGGCTCGGAAAATGGGGATGGGGAGTCCTTGCTCAGTTCCCCCATCTCTAAGGCACTCAAAGAAGGAGAGGAGAGCCCAAGCTCAATTAGCCCCCTGGGCTCAGAATCTGGATCTGATGCTGAAAAAGATGAGCAGGATCCCAGTTCTTCCTCCTCAGCCAGGCAGAGGACCCCCATAGACATCCTGACCAGGGTCTTCCCTGCTCAGAAGAGGAGCGTTCTGGAACTGGTGCTGCAGGGCTGTGGGGGAGATGTGGTTCAAGCAATTGAACAGATACTAAACAACAGGGGACAGGATAAGAGTGAAGAGACCTGGTCAAGAGATGGAGCCCTCCCAAGTATTCAGCCATCAGTGTCCTCCACACACAGACCCCTTATTGCTGGAGCCCTTACTCCTGCTATTGGCACATTAGGGAGCAGGTCTGCATTCTCCCCTTTACAACCCAATGGCGCACACTTTGGCACTGAGGCGCATGCGCATCCCATCTGGGTGGGCACCTTGGGTTAAACCCACTGAGGTTAGCCTATTCTGCGCACAGTAGAGGACTTGCTTTCATGGCCCCTTACTCAACAGCTGGTTTCATGCCTACCCxTxGGTTTCGCCCACCCATGGACTACGCCTTCAGTGACCTTATGAGGGACAGGGCCAATGTTCACAAGGACCAGGTATACACTAATGGACTCTATGGGCCAGTGGTCAATAATAATGCTGAAAAACAATGAATTCTTTATATAAGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGACCGTTCCCTAAGCATTAGAAATAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     4     2     4
                                               BLH ATG     107     231                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     107     157                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MPR      53     157                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH OVR     107     191                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               CDS MIN     107     157                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               ORF LNG     107      16                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 1e-013     XP_795079.2 PREDICTED: similar to DMRT1 form ST1 [Strongylocentrotus purpuratus] ===================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ci ==== 4e-021     FAA00223.1 TPA: transcription factor protein [Ciona intestinalis] ==========================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 3e-022     NP_510466.1 transcription factor (XP476) [Caenorhabditis elegans] =======================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---= 2e-025     XP_001232983.1 PREDICTED: similar to doublesex and mab-3 related transcription factor 1 [Gallus gallus] ===========================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 2e-036     NP_524549.1 doublesex-Mab related 99B CG15504-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Hs ---- 2e-154     XP_946699.1 PREDICTED: similar to doublesex and mab-3 related transcription factor like family A2 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 2e-154     NP_758500.2 doublesex and mab-3 related transcription factor like family A2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 8e-170     NP_001007065.1 doublesex and mab-3 related transcription factor like family A2 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          ABC55871.1 doublesex and mab-3 related transcription factor 5 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === ?? ==== 0          NP_001089148.1 doublesex and mab-3 related transcription factor 5 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          AAI36033.1 Unknown (protein for MGC:122569) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG33177.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAG---------------------------TAA------TAG------------TAGTAA------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------TGA---TAG---------------------------------------------------------------------------------------------------------------TGA------------ATG------------------------ATG------ATG------------------ATG------------------------TAA------------------------------------TGA---TAG---------ATG---------------------------------------------------------------------------TGA------TAG------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------TGA---------------------TAA---------------ATG---TGA------------------------------------------------TGATAA---------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------ATGTGA---------------TAG---TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  0   1   1           Brn3 FL                          CAAK4997.FL-MGC GACCTGCTGCCTGGCATCGGATCTCTCACCTCTCCGGGGAAGTCGCTGGTCTGACAGCCCAACCGGCAGCCTCTACACCTGGGTGCAGTTTATCAGTTTATGTGGGAGAGGTGTGTGCCTGTGGGGGAGACCAGGCTGTGGGTCGGGGGTGAGTGGCCTGAGGGGAGTCGGGGCTAGAGAGTAAGCTGTGTGGGTGAAAGGTACTGAGGGCAAGTTCTGCGCTAATCTATTCTGTCGGATTGGGATACAAATCTATTGGCCCTAATGAGATAATCTGTTGGTACCTGACTGAATGGAAAGGGCACAGGTTTAGGCGGGCACAAGGGCAGTCTATGGGATTGTGTAGAAAAAAACCCAAACAGCTCACCTTACATTTCTTTAGAACTTAATTTACTGCTGTTTCTTGGGGATTTAAGTTTAGTGCCAGTCTGTGTATAGTGCAGACCAGTAAGGCTGGAGCTTTTGCCTTTTGCCATCCCCTGTGTCACTGGGTGAGTGGGTGAGTGGGTAAGGCTGGGGCACCGGGTTATATAGAGGGGCCAGTACACCTGTCATTCATTATAAAGATTATAGGGGGATAGAGTGTAGTAAATCAATTCTAGAATGGAACTGAATGGACCCCCAGTTTCCCAGCTTCCTCAGACCGCAACTTCTACCGCATCACTTCCAGTCACAGTGGCCGGTACTCTCCTACGTGGCCCCCAGCTGCTGCTCCGAGCCGCAGAGAAGTATCCCCGTACCCCCAAGTGCGCCCGCTGCAGGAATCACGGGGTAGTGTCTGCGCTCAAGGGCCACAAGCGCTACTGCCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGATCGCGGAGCGCCAGAGGGTTATGGCCGCGCAAGTTGCGCTACGCAGGCAGCAAGCCCAGGAGGAGAATGAGGCCCGAGAGCTGCAGCTTCTCTATGGAACTGCTGAAGGATTGGCACTGGCGGCAGCCAATGGCATCATCCCACCCCGGCCAGCCTACGAGGTCTTCGGATCGGTGTGTACAGAGGGAGGAACAGATTCAAAGATTCAGAAGTTCGACTTGTTCCCTAAAAGCCTCATCCCCAGATCTGTGACTCCTCAACTGTCTTCTGGGGGAAAACCAGTGTCCCCAGACAGTGAATCGGTGTCAGGCAGTGCACCAGGTGCCTCATCCCCTGAAGCACGGCCTGGTTCTGGCTCGGAAAATGGGGATGGGGAGTCCTTGCTCAGTTCCCCCATCTCTAAGGCACTCAAAGAAGGAGAGGAGAGCCCAAGCTCAATTAGCCCCCTGGGCTCAGAATCTGGATCTGATGCTGAAAAAGATGAGCAGGATCCCAGTTCTTCCTCCTCAGCCAGGCAGAGGACCCCCATAGACATCCTGACCAGGGTCTTCCCTGCTCAGAAGAGGAGCGTTCTGGAACTGGTGCTGCAGGGCTGTGGGGGAGATGTGGTTCAAGCAATTGAACAGATACTAAACAACAGGGGACAGGATAAGAGTGAAGAGACCTGGTCAAGAGATGGAGCCCTCCCAAGTATTCAGCCATCAGTGTCCTCCACACACAGACCCCTTATTGCTGGAGCCCTTACTCCTGCTATTGGCACATTAGGGAGCAGGTCTGCATTCTCCCCTTTACAACCCAATGGCGCACACTTTGGCACTGAGGCTAATGCATACCAGCTTGGTGGGCACCTTGGGTTAAACCCACTGAGGTTAGCCTATTCTGCGCACAGTAGAGGACTTGCTTTCATGGCCCCTTACTCAACAGCTGGTTTCATGCCTACCCTTGGCTTTCGCCCACCCATGGACTACGCCTTCAGTGACCTTATGAGGGACAGGGCCAATGTTCACAAGGACCAGGTATACACTAATGGACTCTATGGGCCAGTGGTCAATAATAATGCTGAAAAACAATGAATTCTTTATATAAGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGACCGTTCCCTAAGCATTAGAAATAAATGTTATTTTCTAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FL   in                         CAAK4997.5p   CCTGCTGCCTGGCATCGGATCTCTCACCTCTCCGGGGAAGTCGCTGGTCTGACAGCCCAACCGGCAGCCTCTACACCTGGGTGCAGTTTATCAGTTTATGTGGGAGAGGTGTGTGCCTGTGGGGGAGACCAGGCTGTGGGTCGGGGGTGAGTGGCCTGAGGGGAGTCGGGGCTAGAGAGTAAGCTGTGTGGGTGAAAGGTACTGAGGGCAAGTTCTGCGCTAATCTATTCTGTCGGATTGGGATACAAATCTATTGGCCCTAATGAGATAATCTGTTGGTACCTGACTGAATGGAAAGGGCACAGGTTTAGGCGGGCACAAGGGCAGTCTATGGGATTGTGTAGAAAAAAACCCAAACAGCTCACCTTACATTTCTTTAGAACTTAATTTACTGCTGTTTCTTGGGGATTTAAGTTTAGTGCCAGTCTGTGTATAGTGCAGACCAGTAAGGCTGGAGCTTTTGCCTTTTGCCATCCCCTGTGTCACTGGGTGAGTGGGTGAGTGGGTAAGGCTGGGGCACCGGGTTATATAGAGGGGCCAGTACACCTGTCATTCATTATAAAGATTATAGGGGGATAGAGTGTAGTAAATCAATTCTAGAATGGAACTGAATGGACCCCCAGTTTCCCAGCTTCCTCAGACCGCAACTTCTACCGCATCACTTCCAGTCACAGTGGCCGGTACTCTCCTACGTGGCCCCCAGCTGCTGCTCCGAGCCGCAGAGAAGTATCCCCGTACCCCCAAGTGCGCCCGCTGCAGGAATCACGGGGTAGTGTCTGCGCTCAAGGGCCACAAGCGCTACTGCCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGAT
  5   1   2   12  bld Gas7 5g3  in                         XZG33177.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGTGGGTAAGGCTGGGGCACCGGGTTATATAGAGGGGCCAGTACACCTGGGTGAGTGGGTAAGGCTGGGGCACCGGGTTATATAGAGGGGCCAGTACACCTGTCATTCATTATAAAGATTATAGGGGGATAGAGTGTAGTAAATCAATTCTAGAATGGAACTGAATGGACCCCCAGTTTCCCAGCTTCCTCAGACCGCAACTTCTACCGCATCACTTCCAGTCACAGTGGCCGGTACTCTCCTACGAGGCCCCCAGCTGCTGCTCCGAGCCGCAGAGAAGTATCCCCGTACCCCCAAGTGCGCCCGCTGCAGGAATCACGGGGTAGTGTCTGCGCTCAAGGGCCACAAGCGCTACTGCCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGATCGCGGAGCGCCAGAGGGTTATGGCCGCGCAAGTTGCGCTACGCAGGCAGCAAGCCCAGGAGGAGAATGAGGCCCGAGAGCTGCAGCTTCTCTATGGAACTGCTGAAGGATTGGCACTGGCGGCAGCCAATGGCATCATCCCACCCCGGCCAGCCTACGAGGTCTTCGGATCGGTGTGTACAGAGGGAGGAACAGATTCAAAGATTCAGAAGTTCGACTTGTTCCCTAAAAGCCTCATCCCCAGATCTGTGACTCCTCAACTGTCTTCTGGGGGAAAACCAGTGTCCCCAGACAGTGAATCGGTGTCAGGCAGTGCACCAGGTGCCTCATCCCCTGAAGCACGGCCTGGTTCTGGCTCGGAAAATGGGGATGGGGAGTCCTTGCTCAGT
  5   1   2      skin Tad5                                 XZT19482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTGTCTGCGCTCAAGGGCCACAAGCGCTACTGCCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGATCGCGGAGCGCCAGAGGGTTATGGCCGCGCAAGTTGCGCTACGCAGGCAGCAAGCCCAGGAGGAGAATGAGGCCCGAGAGCTGCAGCTTCTCTATGGAACTGCTGAAGGATTGGCACTGGCGGCAGCCAATGGCATCATCCCACCCCGGCCAGCCTACGAGGTCTTCGGATCGGTGTGTACAGAGGGAGGAACAGATTCAAAGATTCAGAAGTTCGACTTGTTCCCTAAAAGCCTCATCCCCAGATCTGTGACTCCTCAACTGTCTTCTGGGGGAAAACCAGTGTCCCCAGACAGTGAATCGGTGTCAGGCAGTGCACCAGGTGCCTCATCCCCTGAAGCACGGCCTGGTTCTGGCTCGGAAAATGGGGATGGGGAGTCCTTGCTCAGTTCCCCCATCTCTAAGGCACTCAAAGAAGGAGAGGAGAGCCCAAGCTCAATTAGCCCCCTGGGCTCAGAATCTGGATCTGATGCTGAAAAAGATGAGCAGGATCCCAGTTCTTCCTCCTCAGCCAGGCAGAGGACCCCCATAGACATCCTGACCAGGGTCTTCCCTGCTCAGAAGAGGAGCGTTCTGGAACTGGTGCTGCAGGGCTGTGGGGGAGATGTGGTTCAAGCAATTGAACAGATACTAAACAACAGGGGACAGGATAAGAGTGAAGAGACCTGGTCAAGAGATGGAGCCCTCCCAAGTATTCAGCCATCAGTGTCCTCCACACACAGACCCCTTATTGCTGGAGCCCT
  5   1   2      shim Neu                           TNeu067l14.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCTGGAAAGACTGTATGTGCGCAAAGTGTACGCTGATCGCGGAGCGCCAGAGGGTTATGGCCGCGCAAGTTGCGCTACGCAGGCAGCAAGCCCAGGAGGAGAATGAGGCCCGAGAGCTGCAGCTTCTCTATGGAACTGCTGAAGGATTGGCACTGGCGGCAGCCAATGGCATCATCCCACCCCGGCCAGCCTACGAGGGGGGCGGATCGGTGTGTACAGAGGGAGGAACAGATTCAAAGATTCAGAAGTTCGACTTGTTCCCTAAAAGCCTCATCCCCAGATCTGTGACTCCTCAACTGTGTTCTGGGGGAAAACCAGTGTGCCCAAACAGTGAATCGGTGTCAGGCAGTGCACCAGGTGCCTCATCCCCTGAAGCACGGCCTGGTTCTGGCTCGGAAAATGGGGATGGGGAGTCCTTGCTCATTCCCCCATCTCTAAGGCGCTCAAAGAAGGAGAGGAGAGCCCAAGCTCAATTAGCCCCCTGGGCTCAGAATCTGGATCTGATGCTGAAAA
  5   1   2      skin Neu       in                   TNeu116d07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGCACTCAAAGAAGGAGAGGAGAGCCCAAGCTCAATTAGCCCCCTGGGCTCAGAATCTGGATCTGATGCTGAAAAAGATGAGCAGGATCCCAGTTCTTCCTCCTCAGCCAGGCAGAGGACCCCCATAGACATCCTGACCAGGGTCTTCCCTGCTCAGAAGAGGAGCGTTCTGGAACTGGTGCTGCAGGGCTGTGGGGGAGATGTGGTTCAAGCAATTGAACAGATACTAAACAACAGGGGACAGGATAAGAGTGAAGAGACCTGGTCAAGAGATGGAGCCCTCCCAAGTATTCAGCCATCAGTGTCCTCCACACACAGACCCCTTATTGCTGGAGCCCTTACTCCTGCTATTGGCACATTAGGGAGCAGGTCTGCATTCTCCCCTTTACAACCCAATGGCGCACACTTTGGCACTGAGGCGCATGCGCATCCCATCTGGGTGGGCACCTTGGGTTAAACCCACTGAGGTTAGCCTATTCTGCGCACAGTAGAGGACTTGCTTTCATGGCCCCTTACTCAACAGCTGGTTTCATGCCTACCCTTGGC
  3   1   2       bld Gas7 5g3  in                         XZG33177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCTGGTTTCATGCCTACCCTTGGTTTCGCCCACCCATGGACTACGCCTTCAGTGACCTTATGAGGGACAGGGCCAATGTTCACAAGGACCAGGTATACACTAATGGACTCTATGGGCCAGTGGTCAATAATAATGCTGAAAAACAATGAATTCTTTATATAAGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGACCGTTCCCTAAGCATTAGAAATAAATGTTATTTTCT
  3   1   2       bld Neu       in                    TNeu116d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCATGCCTACCCTTGGCTTTCGCCCACCCATGGACTACGCCTTCAGTGACCTTATGAGGGACAGGGCCAATGTTCACAAGGACCAGGTATACACTAATGGACTCTATGGGCCAGTGGTCAATAATAATGCTGAAAAACAATGAATTCTTTATATAAGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGAACGTTCCCTAAGCCCATTAGAAATAAANNTGTTATTTTCTAAAAAAAAAAAAAAAAAA
  3   1   2      seed Brn3 FL   in                         CAAK4997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCCACCCATGGACTACGCCTTCAGTGACCTTATGAGGGACAGGGCCAATGTTCACAAGGACCAGGTATACACTAATGGACTCTATGGGCCAGTGGTCAATAATAATGCTGAAAAACAATGAATTCTTTATATAAGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGACCGTTCCCTAAGCATTAGAAATAAATGTTATTTTCT
  5   1   2       bld Tad5                                  XZT4360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGACCTGAAAAACCTGTGGCTTGCAGGCTCAGATTCTGATTTTAGGGTATTTCCATGGGTTTGGATAACAAATGTCATAAAGTCTTAAGAACATCTCAAGTAATCAAGAAGTCTGAAGCCCAGTCTGGAGAATGAACTAGTTAGGTAGAGCACTGTAAAGACATTCCTATTCTCTGCAAGGCAACGTGATGCTTTCTGGATTTTTGGAGGACATGGAAATTCCTAAATCATTATAAAATACAAACTGCACTTTTTCTGTTAATAAAAGGGGTGACGTTATTTCTGCTTAAGGATATAAGCACGGACACAAGTCCCAATCCATTGTGATATTATAAATATATACATATATAAATATATAGACTTCTAATGTTATGAGCTGGGATTCTAAGTTATTCTTGTACATTGGCATTGAACCCTTTCTCATGATAACAAGGAGCCCTGTTATGGCACGCTACAAGTGCAACAGGGTGCAGCAGCATAGACTGCTCTGTGTGTACAGATGTGGGTAGGAATGGGGGGGGGGCAGCATTCAGATCCCCCTTTATTTGGTGAATTTCAAACCATTGCTGTTGGTTTAATTGTTTAGAAAATTGTTAACACCTTTATGTGACCGTTCCCTAAGCATTAGAAATAAATGTTATTTTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)