Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012090766 Xt7.1-XZT52596.5 - 6 ESTs
                                                                       .....-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT52596.5                                                                                      TGACACTGGCGATTGCGACTCCATATCAGGGCAGGATTCTGTGTCGCTAAACTCCTGGTTGACATTAACTGCAATAGTACTTGTGGACTGGCTCTGCACTTTCTAAAGGGCAGGGACAATGGACTTCTCTTGATGGATGAGTGGACACTGGAAGATGGAATGAAACTAAACTTAAATAAAGATATAAAACCTATTAAAACTGAAAAGGCTCGAGCAAGCTAAGCCATATGTATCAAAACGAAAACGAGAGATCTATGACTGTTATATTCCTGGCTAACAGAAAAAAAATGGTTCCTTCAATAAAAAGACTGCTGCCATGGTAACACCACCAGATACAAAGACCTTAACAAAGAGTGATGCCAAAAGCAGACGGATTATCATAACTCTGCAAGTTGCAGGGACCTCACAATGGAAAGCTTTTAAAGGATGGCTGCCTCAAATAGGACTACTACCATGACAGGGTCAGTTACGATCAATCACATGTCTGTTCTGAAAGTTTCCGAATGCAGAAGGACAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCGTCATTCTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAGAGAAGGCTTGAGTCTAAGCAAAAATAAAATGTATTTATCCTTTTGTATTCAAATGAAGTTATTTTTCTTGAAATAATGTACAATGTAGATTTTTTGTATTATTGCAAATTCGTGTTTAACAGACAATCTATTAAGTAAATTTCATTCAATACAGAATGAAAATATAGCTTTTTTTCTTCAACTTATCAATTTATTTTTCGTTGAATTTTATTTT
                                                  Xt7.1-CHK-1008241372                                                                                            TGGCGATTGCGACTCCATATCAGGGCAGGATTCTGTGTCGCTAAACTCCTGGTTGACATTAACTGCAATAGTACTTGTGGACTGGCTCTGCACTTTCTAAAGGGCAGGGACAATGGACTTCTCTTGATGGATGAGTGGACACTGGAAGATGGAATGAAACTAAACTTAAATAAAGATATAAAACCTATTAAAACTGAAAAGGCTCGAGCAAGCTAAGCCATATGTATCAAAACGAAAACGAGAGATCTATGACTGTTATATTCCTGGCTAACAGAAAAAAAATGGTTCxTxxAATAAAAAGACTGCTGCCATGGTAACACCACCAGATACAAAGACCTTAACAAAGAGTGATGCCAAAAGCAGACGGATTATCATAACTCTGCAAGTTGCAGGGACCTCACAATGGAAAGCTTTTAAAGGATGGCTGCCTCAAATAGGACTACTACCATGACAGGGTCAGTTACGATCAATCACATGTCTGTTCTGAAAGTTTCCGAATGCAGAAGGACAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCGTCATTCTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAGAGAAGGCTTGAGTCTAAGCAAAAATAAAATGTATTTATCCTTTTGTATTCAAATGAAGTTATTTTTCTTGAAATAATGTACAATGTAGATTTTTTGTATTATTGCAAATTCGTGTTTAACAGACAATCTATTAAGTAAATTTCATTCAATACAGAATGAAAATATAGCTTTTTTTCTTCAACTTATCAATTTATTTTTCGTTGAATTTTATTTTTTTTGT
                                                      consensus depths                                                                                           2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     5     3     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                      Xt7.1-XZT52596.5                                                                                      TGA---------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------TAA---------------------------------TGA------------------------------------------TAA---------------------------------------------------TGA---------------------------------------------------ATG---------TAA---ATG------------------------ATG------------------------ATG---------------------------------------ATG------------------------------------------------------------TAG------------------------------TAA------------------------------------------------TGA---------------------------------------------------------------------------TAG---------------------------------------TGATGA---------TAA---TAA---------------------------------------------ATG---------------------ATG------------------TAA------ATGTAG
  5   1   2      skin BrSp      in                     EC2BBA16DD03.g1 GGAATGATGGTGTTTGCTACAACAACATTAGGTGCCACTGTCCCTCTGGCTACACAGGCATCTTGTGTGAAAAGCAAAAGTGCGCTGACACTGGCGATTGCGACTCCATATCAGGGCAGGATTCTGTGTCGCTAAACTCCTGGTTGACATTAACTGCAATAGTACTTGTGGACTGGCTCTGCACTTTCTAAAGGGCAGGGACAATGGACTTCTCTTGATGGATGAGTGGACACTGGAAGATGGAATGAAACTAAACTTAAATAAAGATATAAAACCTATTAAAACTGAAAAGGCTCGAGCAAGCTAAGCCATATGTATCAAAACGAAAACGAGAGATCTATGACTGTTATATTCCTGGCTAACAGAAAAAAAATGGTTCCTTCAAATAAAAAGACTGCTGCCATGGTAACACCACCAGATACAAAGACCTTAACAAAGAGTGATGCCAAAAGCAGACGGATTATCATAACTCTGCAAGTTGCAGGGACCTCACAATGGAAAGCTTTTAAAGGATGGCTGCCTCAAATAGGACTACTACCATGACAGGGTCAGTTACGATCAATCACATGTCTGTTCTGAAAGTTTCCGAATGCAGAAGGACAAAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCG
  5   1   2       bld Tad5      in                          XZT4712.5p                                                                          GAGCGTGGGCGCTGACACTGGCGATTGCGACTCCATATCAGGGCAGGATTCTGTGTCGCTAAACTCCTGGTTGACATTAACTGCAATAGTACTTGTGGACTGGCTCTGCACTTTCTAAAGGGCAGGGACAATGGACTTCTCTTGATGGATGAGTGGACACTGGAAGATGGAATGAAACTAAACTTAAATAAAGATATAAAACCTATTAAAACTGAAAAGGCTCGAGCAAGCTAAGCCATATGTATCAAAACGAAAACGAGAGATCTATGACTGTTATATTCCTGGCTAACAGAAAAAAATGGTTCCTTCAAATAAAAAGACTGCTGCCATGGTAACACCACCAGATACAAAGACCTTAACAAAGAGTGATGCCAAAAGCAGACGGATTATCATAACTCTGCAAGTTGCAGGGACCTCACAATGGAAAGCTTTTAAAGGATGGCTGCCTCAAATAGGACTACTACCATGACAGGGTCAGTTACGATCAATCACATGTCTGTTCTGAAAGTTTCCGAATGCAGAAGGACAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCGTCATTCTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAG
  5   1   2      seed Tad5                                 XZT52596.5p                                                                                                                                                                                                                                                                                                                                                                                              CTCTTCTACAGACTGCTGCCATGGTAACACCACCAGATACAAAGACCTTAACAAAGAGTGATGCCAAAAGCAGACGGATTATCATAACTCTGCAAGTTGCAGGGACCTCACAATGGAAAGCTTTTAAAGGATGGCTGCCTCAAATAGGACTACTACCATGACAGGGTCAGTTACGATCAATCACATGTCTGTTCTGAAAGTTTCCGAATGCAGAAGGACAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCGTCATTCTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAGAGAAGGCTTGAGTCTAAGCAAAAATAAAATGTATTTATCCTTTTGTATTCAAATGAAGTTATTTTTCTTGAAATAATGTACAATGTAGATTTTTTGTATTATTGCAAATTCGTGTTTAACAGACAATCTATTAAGTAAATTTCATTCAATACAGAATGAAAATATAGCTTTTTTTCTTCAACTTATCAATTTATTTTTCGTTGAATTTTATTTTTTTGTGTTATTCATTTTTCACCCCTTAGCGACCAGAGGGGCT
  3   1   2       bld Eye                                  CCAX4102.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGGGTCAGTTACGATCAATCACATGTCTGTTCTGAAAGTTTCCGAATGCAGAAGGACAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCGTCATTTTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAGAGAAGGCTTGAGTCTAAGCAAAAATAAAATGTATTTATCCTTTTGTATTC
  3   1   2       bld BrSp      in                     EC2BBA16DD03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAAGTTTCCGAATGCAGAAGGACAAAAAAAAAATGCTTGTTAGACACTTCCACGTGGTCATTGTACCTCGCTGCCCAGTGTGTGGACCAACCAAATAGCGTCATTCTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAGAGAAGGCTTGAGTCTAAGCAAAAATAAAATGTATTTATCCTTTTGTATTCAAATGAAGTTATTTTTTTGAAATAATGTACAATGTAGATTTTTTGTATTATTGCAAATTCGTGTTTAACAGACAATCTATTAAGTAAATTTCATTCAATACAGAATGAAAATATAGCTTTTTTTCTTCAACTTATCAATTTATTTTTCGTTGAATTTTATTTTTTTGTGTTATTCATTTTTCACCCCTTAGCGACCAGAGGGGCTTGAAGTTCCCCAGGACCCCTTTGGCCGTAAAACGGGTAAATTGCAAAGAAAATCTTCCATAGGGAGCGAGTGCTGGTATCATGGAGAGCCACAAGTTTACATATATAAGACGTGTAATAATGTTCCACCAAAGGAAATTCTAAATGTTTTCTTGTTGTTTTAAAACATGGAATATTTCAAAGG
  3   1   2       bld Tad5      in                          XZT4712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCAAATAGCGTCATTCTTTGCTGCCAGTGCATTGTGGGTAAAGGAAAGCGGCCATATTGGTCCCCGATACCCTTACACCTGTGCTTTTGTGAACGTCGCTCCGTAAACCCTCGTTGGTCAAAAGATTTTATTTGTCCGATGTTAGTGGTGCACATAACTCCCTCCTTTAGCCCCCGAGAGAGAATTTCGAGGCTTGTACATGCTTGATATGATGACATGCTGATTAAGATTAAGGTGTATCAAGAAACAGAGAAGGCTTGAGTCTAAGCAAAAATAAAATGTATTTATCCTTTTGTATTCAAATGAAGTTATTTTTCTTGAAATAATGTACAATGTAGATTTTTTGTATTATTGCAAATTCGTGTTTAACAGACAATCTATTAAGTAAATTTCATTCAATACAGAATGAAAATATAGCTTTTTTTCTTCAACTTATCAATTTATTTTTCGTTGAATTTTATTTTTTTTGTGTTATTCATTTTTCACCCCTTAGCGACCAGAGGGGCTTGAAGTTCCCCAGGACCCCTTTGGCCGTAAAACGGGTAAATTGCAAAGAAAATCTTCCATAGGGAGCGAGTGCTGGTATCATGGAGAGCCACAAGTTTACATATATAAGACGTGTAATAATGTTCCACCAAAGGAAATTCTAAATGTTTTCTTGTTGTTTTAAAACATTGGAATATTTCAAAGGAATAAAACATATCTGAAAACTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)