Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 179.0    0Xt7.1-CAAM4898.5                            2 PI      100       436      529                dynein, axonemal, heavy polypeptide 5 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012091125 Xt7.1-XZT65123.3 - 6 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT65123.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGCAGGCGAGGGAAGAAACCAATTGCTTTTTGACTGCACGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTT
                                                  Xt7.1-CHK-1008241337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGxxxxGxAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGxxxGxxAGGGAAGAAACCAATTGCxxxxxxACTGCAxxGAGxAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGAxxxxxxAAATGGAxxxxGxAxxAxATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTTTATATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     6     3     6     3     6     3     6     3     6     3     5     3     6     3     6     3     6     3     5     3     6     3     6     5     6     5     6     5     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     5     5     4     4     4     4     3     4     3     4     2     3     2     3     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGGATTTTTTAATCCTCAGGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTC
                                               BLH MIN      45      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - ?? ---- 1e-017     XP_683805.1 PREDICTED: similar to CG17866-PA.3, partial [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 4e-020     AAI27558.1 Unknown (protein for IMAGE:7677867) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-043     NP_649923.2 CG9492-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 5e-046     XP_684382.1 PREDICTED: similar to dynein, axonemal, heavy polypeptide 5, partial [Danio rerio] ===============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 4e-054     XP_001179512.1 PREDICTED: similar to axonemal dynein heavy chain 8 long form, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 8e-069     XP_419006.2 PREDICTED: similar to axonemal dynein heavy chain DNAH5 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 6e-069     NP_579943.2 dynein, axonemal, heavy chain 5 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-072     NP_001360.1 dynein, axonemal, heavy polypeptide 5 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT65123.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------TAA------------------------------TGA---------ATG---------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TGA------------------TAA---------------------------------------------ATG------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                 ]
  5   1   2      skin Gas8      in                          st55k02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGCTGATCATGGAGGGAAGAGCTGGGCCCAGGGAACAGTAAGGGAGAGGGAAGGGGTAGCAGGAACGGCCCAGGCTGCGTGGAACGCAGCCCACATGGGGGCTGGCACCCAGGGTGCCAGGGTTACAAAAAGAGGTGAGCCTGGGGTGCATGGCGGGCCCCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGGGAAGGAGGCCTGCCTAGGGCCGAGATGAGATTAGGCAGGAAGAGGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCAGCAGCAGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGACGCGACAAAGAGGATTTTGCGATGATCAGGAGCTCCGGTGCTAAGAGAAAGGGAACATTTCTTTCCCCAGGTGAAGGCTCCAGGAGGCGGCAGAAGTTGACGGACGGCAGCATCGGCGGCAGGCGAGGGAAGAAACCAATTGCGGAAGACTGCGCCGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTCACGGGAGCCGGAAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTCTTGATGGANCTGGCTGGNACAGACGAAATCTTAACTGATGGGAAGGAGCCTGCNTAGGCCCANATAAATTAGGCAANAAAAGATATACTTCNCAAAAACATCGATTCTCTCNTGTCC
  5   1   2       bld Tad5      in                         XZT65123.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTTTTAAGGCAAGAAATTGACAGAATGCAGAGAATCATAAGTTTGGTGAGAACAACCTTAACAGACCTAAAACTTGCCATTGATGGTACCATTATAATGAGTGAAAACCTCAGAGATGCTTTGGATTGTATGTATGATGCAAGAATTCCTGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGACAGGATTTTTTAATCCTCAGGGATTTTTGACTGCAATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACCAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTG
  3   1   0       add Gas8      out                         st55j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCCNCAAAGACATCGNTTTTATTCTNTTCCATTACAAGAAANCAGTCGGAACTGACTTAAATATATTGCTGCAGTGATCNGCAGCNGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGACTCGACAAAGAGGATTTTGCGATGATCAGGAGCTCCGGTGTTAAGAGAAAGGGAACATTTCTTTCCCCAGGTGAAGGCTCCAGGAGGCGGCAGAAGTTGACGGACGGCAGCATCGGCGGNCAGGCGAGGGAAGAAACCAATTGCGGAAGANTGCGCCGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTCNNGGGAGCCGGAAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTCTTGANGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGGGAAGGAGGCNTGCCTAGGGCCGAGATGAGATTAGGCAAGAAGAGGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCANTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGGTCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGACTTCAAATAATTCATCAGCCTTTTTTCCCCAAAGTGATATTTGTTNATANTTCTTTAAANTTAATTTTTTTGTTGTCCCCT
  3   1   2       bld Gas8      in                          st55k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAAGNCATCGATTNTACTCCTGTCCCATTTACCAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTGATCAGCAGCAGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGACGCGACAAAGAGGATTTTGCGATGATCAGGAGCTCCGGTGCTAAGAGAAAGGGAACATTTCTTTCCCCAGGTGAAGGCTCCAGGAGGCGGCAGAAGTTGACGGACGGCAGCATCGGCGGCAGGCGAGGGAAGAAACCAATTGCGGAAGACTGCGCCGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTCACGGGAGCCGGAAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGGGAAGGAGGCCTGCCTAGGGCCGAGATGAGATTAGGCAAGAAGAGGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGGTCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGACTTCAAATAATTCATCAGCCTTTTTTCCCCAAATTGATATTTGTTAATATTTCTTTAAAATTAATTTTTTTGTTGTCCCCTTAGCATTACAAAACCCTTGTGATATGTTTAAGATAAGATAGCACCGTTTGCTCCCTTTTCTATTGT
  3   1   2      seed Tad5      in                         XZT65123.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGATGCTTTGGATTGTATGTATGATGCAAGAATTCCTGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGACAGGATTTTTTAATCCTCAGGGATTTTTGACTGCAATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACCAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTTTATATAGAT
  3   1   2       bld Ovi1      out                         CABI585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGACAGGATTTTTTAATCCTCAGGGATTTTTGACTGCAATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACCAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTTTATATAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)