Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 179.0    0Xt7.1-CAAM4898.5                            2 PI      100       436      529                dynein, axonemal, heavy polypeptide 5 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012091125 Xt7.1-XZT65123.3 - 6 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT65123.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGCAGGCGAGGGAAGAAACCAATTGCTTTTTGACTGCACGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTT
                                                  Xt7.1-CHK-1008241337                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGxxxxGxAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGxxxGxxAGGGAAGAAACCAATTGCxxxxxxACTGCAxxGAGxAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGAxxxxxxAAATGGAxxxxGxAxxAxATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTTTATATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     6     3     6     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     6     3     6     3     6     3     6     3     6     3     5     3     6     3     6     3     6     3     5     3     6     3     6     5     6     5     6     5     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     5     5     4     4     4     4     3     4     3     4     2     3     2     3     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGGATTTTTTAATCCTCAGGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTC
                                               BLH MIN      45      42                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - ?? ---- 1e-017     XP_683805.1 PREDICTED: similar to CG17866-PA.3, partial [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 4e-020     AAI27558.1 Unknown (protein for IMAGE:7677867) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-043     NP_649923.2 CG9492-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 5e-046     XP_684382.1 PREDICTED: similar to dynein, axonemal, heavy polypeptide 5, partial [Danio rerio] ===============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 4e-054     XP_001179512.1 PREDICTED: similar to axonemal dynein heavy chain 8 long form, partial [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 8e-069     XP_419006.2 PREDICTED: similar to axonemal dynein heavy chain DNAH5 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 6e-069     NP_579943.2 dynein, axonemal, heavy chain 5 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-072     NP_001360.1 dynein, axonemal, heavy polypeptide 5 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT65123.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------TAA------------------------------TGA---------ATG---------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TGA------------------TAA---------------------------------------------ATG------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Tad5      in                         XZT65123.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTTTTAAGGCAAGAAATTGACAGAATGCAGAGAATCATAAGTTTGGTGAGAACAACCTTAACAGACCTAAAACTTGCCATTGATGGTACCATTATAATGAGTGAAAACCTCAGAGATGCTTTGGATTGTATGTATGATGCAAGAATTCCTGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGACAGGATTTTTTAATCCTCAGGGATTTTTGACTGCAATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACCAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTG
  3   1   0       add Gas8      out                         st55j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCCNCAAAGACATCGNTTTTATTCTNTTCCATTACAAGAAANCAGTCGGAACTGACTTAAATATATTGCTGCAGTGATCNGCAGCNGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGACTCGACAAAGAGGATTTTGCGATGATCAGGAGCTCCGGTGTTAAGAGAAAGGGAACATTTCTTTCCCCAGGTGAAGGCTCCAGGAGGCGGCAGAAGTTGACGGACGGCAGCATCGGCGGNCAGGCGAGGGAAGAAACCAATTGCGGAAGANTGCGCCGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTCNNGGGAGCCGGAAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTCTTGANGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGGGAAGGAGGCNTGCCTAGGGCCGAGATGAGATTAGGCAAGAAGAGGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCANTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGGTCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGACTTCAAATAATTCATCAGCCTTTTTTCCCCAAAGTGATATTTGTTNATANTTCTTTAAANTTAATTTTTTTGTTGTCCCCT
  3   1   2       bld Gas8      in                          st55k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAAGNCATCGATTNTACTCCTGTCCCATTTACCAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTGATCAGCAGCAGCAGCATGGGGCAGGCATGAATCGGGCGGGCTGGTGGGAGGAGACGCGACAAAGAGGATTTTGCGATGATCAGGAGCTCCGGTGCTAAGAGAAAGGGAACATTTCTTTCCCCAGGTGAAGGCTCCAGGAGGCGGCAGAAGTTGACGGACGGCAGCATCGGCGGCAGGCGAGGGAAGAAACCAATTGCGGAAGACTGCGCCGGAGGAAGTGGTTCGGAGGAAGAGGTCGGCGGTAATCTCGGAGCGGAAGTATTGCGACGCTTGGATGATGTCACGGGAGCCGGAAGAAGCAAGGGTGCCAGGTGTTACAAAAAGAGGTGAGCCTGGGGCGCATGGCGGGCCTCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGGGAAGGAGGCCTGCCTAGGGCCGAGATGAGATTAGGCAAGAAGAGGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGGTCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGACTTCAAATAATTCATCAGCCTTTTTTCCCCAAATTGATATTTGTTAATATTTCTTTAAAATTAATTTTTTTGTTGTCCCCTTAGCATTACAAAACCCTTGTGATATGTTTAAGATAAGATAGCACCGTTTGCTCCCTTTTCTATTGT
  3   1   2      seed Tad5      in                         XZT65123.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGATGCTTTGGATTGTATGTATGATGCAAGAATTCCTGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGACAGGATTTTTTAATCCTCAGGGATTTTTGACTGCAATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACCAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTTTATATAGAT
  3   1   2       bld Ovi1      out                         CABI585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGCGTTGGAAAAAGGCATCTTGGGAATCAAGTACCCTAGGATTCTGGTTTACTGAACTTCTAGAGAGAAACAAGCAATTTTCTTCTTGGATTTTTGAAAGTCGCCCAAATTGTTTCTGGATGACAGGATTTTTTAATCCTCAGGGATTTTTGACTGCAATGAGACAGGAAATAACCCGTGCTAACAAAGGGTGGGCATTAGACAGTGTGATAATATGCAATGAGGTCACCAAATGGATGAAGGATGATATAACAGCACCAGCATCTGAGGGTGTCTATGTTTATGGCTTGTACCTTGATGGAGCTGGCTGGGACAGACGAAATCTTAAGCTGATGGAATCTAAGCCAAAAGTATTATTTGAAATAATGCCTGTTATCAGAATATATGCAGATAATACATCCACAAAAGACAATCGATTCTACTCCTGTCCCATTTACAAGAAACCAGTCCGAACTGACTTAAATTATATTGCTGCAGTTGATCTGAAAACTGTCCAGTCTCCAGACCATTGGATATTGCGGGGTGTGGCTTTGTTATGTGATGTCAAATAATTCATCAGCCTTTTTCCCCCAAATTGATATTTGTTAATACTTCTTTAAAATTATTTTTTTTGTTGTCCCCTTAGCATTACAAAACCTTGTAATATGTTTAAGATAAGATAGCACTGTTTGCTCCCTTTTCTATTGTTTTTATTTATAAAACACTTGAGAAATATATATGTTTATATAG

In case of problems mail me! (