Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012091309 Xt7.1-CAAQ5644.3 - 5 ESTs
                                                                       .......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAQ5644.3                                                                                                                                                                                                                          GCTACAAAATAACTGGTTTAGCCAGGATTTTACCTTCTTGTGATCGACAGACACTCTGCAGCACAGCAAAGCTCCATCTGGACTGCACTACGTACAGATGGTATGCTGGGCCTCAACTCAGCTCAGCGTTTGACCGCAATAAAGGCCTCTATAACAGAGCAGCTTTCCATTCTGTACAACCAAAGGTGGATAGAGTAATGTCCATGTTGTACTACACTTTGTTTATAGCAATTCTCATCAGCGTACAGGCTGCACCAAAGACCAAAGACCATGCCCCAGCAAGGTCTTCAGCAAAATCCCGCATTCCTCATCACACACATCGAACTAAGTCTCTTCACCATCACCATGGAAAACTAGAGGCAAAGGAGCCTTCGTACTTTCACAATGTCACAGTGGACCCTAAACTTTTTAGAAAAAGGAAATTTCGATCTCCACGAGTTTTGTTTAGTACTCAACCTCCTCCATTGTCCGAGGACATACGAAATTTGCAATACTTGGACGATGAGGAATCTCTTAACAAAACCATCCGGTCTAAGAGGACAGTGCATCCGGTTCTTCACCGAGGGGAGTACTCTGTATGTGACAGCGTCAGTATGTGGGTTGGGGAAAAGACTACAGCCACCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTGAGACCAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGTGGGATTGATGCAAAGCATTGGAACTCTTATTGTACCACCACGCACACCTTTGTCAAAGCATTAACAATGGAAGGGAAGCAAGCAGCATGGAGATTCATACGGATTGATACAGCATGTGTCTGTGTGCTAAGCAGGAAAGGTCGAACCTAAGTGAAAACATTCTTGCCATCCCATCTTCTCCCCACCCCTACCT
                                                  Xt7.1-CHK-1008243470                                                                                                                                                                                                                                AAATAACTGGTTTAGCCAGGATTTTACCTTCTTGTGATCGACAGACACTCTGCAGCACAGCAAAGCTCCATCTGGACTGCACTACGTACAGATGGTATGCTGGGCCTCAACTCAGCTCAGCGTTTGACCGCAATAAAGGCCTCTATAACAGAGCAGCTTTCCATTCTGTACAACCAAAGGTGGATAGAGTAATGTCCATGTTGTACTACACTTTGTTTATAGCAATTCTCATCAGCGTACAGGCTGCACCAAAGACCAAAGACCATGCCCCAGCAAGGTCTTCAGCAAAATCCCGCATTCCTCATCACACACATCGAACTAAGTCTCTTCACCATCACCATGGAAAACTAGAGGCAAAGGAGCCTTCGTACTTTCACAATGTCACAGTGGACCCTAAACTTTTTAGAAAAAGGAAATTTCGATCTCCACGAGTTTTGTTTAGTACTCAACCTCCTCCATTGTCCGAGGACATACGAAATTTGCAATACTTGGACGATGAGGAATCTCTTAACAAAACCATCCGGTCTAAGAGGACAGTGCATCCGGTTCTTCACCGAGGGGAGTACTCTGTATGTGACAGCGTCAGTATGTGGGTTGGGGAAAAGACTACAGCCACCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTGAGACCAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGTGGGATTGATGCAAAGCATTGGAACTCTTATTGTACCACCACGCACACCTTTGTCAAAGCATTAACAATGGAAGGGAAGCAAGCAGCATGGAGATTCATACGGATTGATACAGCATGTGTCTGTGTGCTAAGCAGGAAAGGTCGAACCTAAGTGAAAACATTCTTGCCATCCCATCTTCTCCCCACCCCTACCTCAGCCT
                                                      consensus depths                                                                                                                                                                                                                               2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3
                                               BLH MIN      98      60                                                                                                                                                                                                                          
                                                                       PROTEIN --- Sp ---- 1e-011     NP_001073024.1 neurotrophin 5 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 2e-019     ABE27004.1 prepro-neurotrophin [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 1e-043     NP_001016370.1 neurotrophin-3 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 3e-044     NP_001084090.1 neurotrophin-3 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 3e-048     NP_954680.1 nerve growth factor, beta polypeptide [Danio rerio] ----------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 2e-080     NP_002497.2 nerve growth factor, beta polypeptide precursor [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 1e-084     NP_038637.1 nerve growth factor, beta [Mus musculus] ---------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 6e-088     XP_418016.2 PREDICTED: similar to Beta-nerve growth factor precursor (Beta-NGF) [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 6e-132     CAA39249.1 nerve growth factor prepropeptide [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ5644.3                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld BrSp      in                     EC2BBA33BE02.g1                                                                                                                                                         GGGAGAACAGACATGTGAATGGCTCAGCTGGGTTTCAAAGCATTTTGTGGACTAGGATACAAGAGGCTACAAAATAACTGGTTTAGCCAGGATTTTACCTTCTTGTGATCGACAGACACTCTGCAGCACAGCAAAGCTCCATCTGGACTGCACTACGTACAGATGGTATGCTGGGCCTCAACTCAGCTCAGCGTTTGACCGCAATAAAGGCCTCTATAACAGAGCAGCTTTCCATTCTGTACAACCAAAGGTGGATAGAGTAATGTCCATGTTGTACTACACTTTGTTTATAGCAATTCTCATCAGCGTACAGGCTGCACCAAAGACCAAAGACCATGCCCCAGCAAGGTCTTCAGCAAAATCCCGCATTCCTCATCACACACATCGAACTAAGTCTCTTCACCATCACCATGGAAAACTAGAGGCAAAGGAGCCTTCGTACTTTCACAATGTCACAGTGGACCCTAAACTTTTTAGAAAA
  5   1   2      seed Hrt1      in                         CAAQ5644.5p                                                                                                                                                                                                                          GCTACAAAATAACTGGTTTAGCCAGGATTTTACCTTCTTGTGATCGACAGACACTCTGCAGCACAGCAAAGCTCCATCTGGACTGCACTACGTACAGATGGTATGCTGGGCCTCAACTCAGCTCAGCGTTTGACCGCAATAAAGGCCTCTATAACAGAGCAGCTTTCCATTCTGTACAACCAAAGGTGGATAGAGTAATGTCCATGTTGTACTACACTTTGTTTATAGCAATTCTCATCAGCGTACAGGCTGCACCAAAGACCAAAGACCATGCCCCAGCAAGGTCTTCAGCAAAATCCCGCATTCCTCATCACACACATCGAACTAAGTCTCTTCACCATCACCATGGAAAACTAGAGGCAAAGGAGCCTTCGTACTTTCACAATGTCACAGTGGACCCTAAACTTTTTAGAAAAAGGAAATTTCGATCTCCACGAGTTTTGTTTAGTACTCAACCTCCTCCATTGTCCGAGGACATACGAAATTTGCAATACTTGGACGATGAGGAATCTCTTAACAAAACCATCCGGTCTAAGAGGACAGTGCATCCGGTTCTTCACCGAGGGGAGTACTCTGTATGTGACAGCGTCAGTATGTGGGTTGGGGAAAAGACTACAGCCACCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTGAGACCAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGTGNGATTGATGCAAAGCATTGGAACTCTTATTGTACCACCACGCACACCTTTGTCAAAGCATTAACAATGGA
  5   1   2       bld Liv1 PIPE                            CAAR2683.5p                                                                                                                                                                                                                                                                                                                                                                  TTAGCCAGGATTTTACCTTCTTGTGATCGACAGACACTCTGCAGCACAGGTGGATAGAGTAATGTCCATGTTGTACTACACTTTGTTTATAGCAATTCTCATCAGCGTACAGGCTGCACCAAAGACCAAAGACCATGCCCCAGCAAGGTCTTCAGCAAAATCCCGCATTCCTCATCACACACATCGAACTAAGTCTCTTCACCATCACCATGGAAAACTAGAGGCAAAGGAGCCTTCGTACTTTCACAATGTCACAGTGGACCCTAAACTTTTTAGAAAAAGGAAATTTCGATCTCCACGAGTTTTGTTTAGTACTCAACCTCCTCCATTGTCCGAGGACATACGAAATTTGCAATACTTGGACGATGAGGAATCTCTTAACAAAACCATCCGGTCTAAGAGGACAGTGCATCCGGTTCTTCACCGAGGGGAGTACTCTGTATGTGACAGCGTCAGTATGTGGGTTGGGGAAAAGACTACAGCCACCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTGAGACCAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGTGGGATTGATGCAAAGCATTGGAACTCTTATTGTACCACCACGCACACCTTTGTCAAAGCATTAACAATGGAAGGGAAGCAAGCAGCATGGAGATTCATACGGATTGATACAGCATGTGTCTGTGTGCTAAGCAGGAAAGGTCGAACCTAAGTGAAAACATTCTTGCCATCCCATCTTCTCCCACCCCTACCTCAGCCTGTAAATTATTTTAAATTATATGGACTGCATGGTATATTTATAGTTTATACTGCAAAAAGAGAGACATTATTTATTAATAACAATTTTTAAA
  3   1   2       bld Hrt1      in                         CAAQ5644.3p                                                                                                                                                                                                                                                                                                                                                                                                       TGTACACCAAAGGTGGATAGAGTAATGTCCATGTTGTACTACACTTTGTTTATAGCAATTCTCATCAGCGTACAGGCTGCACCAAAGACCAAAGACCATGCCCCAGCAAGGTCTTCAGCAAAATCCCGCATTCCTCATCACACACATCGAACTAAGTCTCTTCACCATCACCATGGAAAACTAGAGGCAAAGGAGCCTTCGTACTTTCACAATGTCACAGTGGACCCTAAACTTTTTAGAAAAAGGAAATTTCGATCTCCACGAGTTTTGTTTAGTACTCAACCTCCTCCATTGTCCGAGGACATACGAAATTTGCAATACTTGGACGATGAGGAATCTCTTAACAAAACCATCCGGTCTAAGAGGACAGTGCATCCGGTTCTTCACCGAGGGGAGTACTCTGTATGTGACAGCGTCAGTATGTGGGTTGGGGAAAAGACTACAGCCACCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTGAGACCAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGTGGGATTGATGCAAAGCATTGGAACTCTTATTGTACCACCACGCACACCTTTGTCAAAGCATTAACAATGGAAGGGAAGCAAGCAGCATGGAGATTCATACGGATTGATACAGCATGTGTCTGTGTGCTAAGCAGGAAAGGTCGAACCTAAGTGAAAACATTCTTGCCATCCCATCTTCTCCCCACCCCTACCTCAGCCTGTAAATTATTTTAAATTATATGGACTGCATGGTATATTTATAGTTTATACTGCAAAAAGAGAGACATTATTTATTAATAAACAATTTTAAAATTCAAAAAGCCTCTCGCCCTA
  3   1   2       bld BrSp      in                     EC2BBA33BE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTATGTGGGTTGGGGTAAAGACTACAGCCTCCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTAAAAAAAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGGGGGATTGATGCAAAGCATTGGAACTCTTATTGTACCCCCACGCACACCTTTGTCAAAGCATTAACAATGGAAGGGAAGCAAGCAGCATGGAGATTCATACGGATTGATACAGCATGTGTCTGTGTGCTAAGCAGGAAAGGTCGAACCTAAATAAAAACATTCTTGCCATCCCATCTTCTCCCCACCCCTACCTCAGCCTGTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)