Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 28 Feb 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 0%

 1012091309 Xt7.1-CAAQ5644.3 - 5 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                               2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3
                                               BLH MIN      98      60                                                                                                                                                                                                                          
                                                                       PROTEIN --- Sp ---- 1e-011     NP_001073024.1 neurotrophin 5 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 2e-019     ABE27004.1 prepro-neurotrophin [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 1e-043     NP_001016370.1 neurotrophin-3 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 3e-044     NP_001084090.1 neurotrophin-3 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dr ---- 3e-048     NP_954680.1 nerve growth factor, beta polypeptide [Danio rerio] ----------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 2e-080     NP_002497.2 nerve growth factor, beta polypeptide precursor [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 1e-084     NP_038637.1 nerve growth factor, beta [Mus musculus] ---------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 6e-088     XP_418016.2 PREDICTED: similar to Beta-nerve growth factor precursor (Beta-NGF) [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 6e-132     CAA39249.1 nerve growth factor prepropeptide [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ5644.3                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  3   1   2       bld BrSp      in                     EC2BBA33BE02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTATGTGGGTTGGGGTAAAGACTACAGCCTCCGACATCAAGGGCAAGGAGGTGACTGTGTTGGGAGAAGTAAATATAAACAATAGTGTTTTCAAACAGTACTTTTTTAAAAAAAAATGCAGGGACCCAAAGCCAGTTTCAAGCGGATGCCGGGGGATTGATGCAAAGCATTGGAACTCTTATTGTACCCCCACGCACACCTTTGTCAAAGCATTAACAATGGAAGGGAAGCAAGCAGCATGGAGATTCATACGGATTGATACAGCATGTGTCTGTGTGCTAAGCAGGAAAGGTCGAACCTAAATAAAAACATTCTTGCCATCCCATCTTCTCCCCACCCCTACCTCAGCCTGTA

In case of problems mail me! (