Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu129b13.3.5                       25 END     1          20        4                hypothetical LOC496963 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 341.0    0Xt7.1-TNeu129b13.3.5                       25 PI      82          1      279                hypothetical LOC496963 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012091321 Xt7.1-IMAGE:6993680.5 - 5 ESTs
                                                                       ..-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:6993680.5                                           GGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAGGAGAAAGTGGGAGCTGTGCATGCAGAGAACCCAGAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGAACCCAGTGAAGAAGCAGCACAGTCAGGAAAGAGACGGGTAATAGAGAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAAGCAGATCTGACCCATGAAGCAGTCACCAAAGAATCTCAACACAAGAGAAACCAGAGAGCAGTGGGAGACCCTCCTTTGCCTAATGAGGGTTTAGTCTGCAACCCATATAGAACACTGCTTTGTATATCTGACTTTGGCACCACTTCTGCCCAAATCCCTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCT
                                                  Xt7.1-CHK-1008243818                                                 AAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAGGAGAAAGTGGGAGCTGTGCATGCAGAGAACCCAGAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGAACCCAGTGAAGAAGCAGCACAGTCAGGAAAGAGACGGGTAATAGAGAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAAGCAGATCTGACCCATGAAGCAGTCACCAAAGAATCTCAACACAAGAGAAACCAGAGAGCAGTGGGAGACCCTCCTTTGCCTAATGAGGGTTTAGTCTGCAACCCATATAGAACACTGCTTTGTATATCTGACTTTGGCACCACTTCTGCCCAAATCCCTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCT
                                                      consensus depths                                                2     2     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3
                                               EST CLI     -42       1                                           
                                                 Xt7.1-IMAGE:6993680.5                                                                                                                                                                                                                                                         TAA------------------------------------------------------------------------------TAATAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA---------TAG
                                                                   ORF                                          ... open reading frame                                                                                                                                                                                        ]
  5   1   2       bld Neu       out                  TNeu112o02.p1cSP6 CCGGGGGGAAATAGGAGCACAGTTTGTATCTGCTGAGACTGGGGAGAGAAGAAGCTGCACATCCATGTCACCAAGGAAGATAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAAGAGAAAGTGGGAGCTGTGCATGCAGATAACCCATAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGAACCCAGTGAATAATCAGCACAGTCAGGAAAGATACGGGTAATAGATAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAATCAGATCTGACCCATGAAGCAGTCACCAA
  5   1   2       bld Neu                            TNeu063b18.p1cSP6                                           GGAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAGGAGAAAGTGGGAGCTGTGCATGCAGAGAACCCAGAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGAACCCAGTGAAGAAGCAGCACAGTCAGGAAAGAGACGGGTAATAGAGAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAAGCAGATCTGACCCATGAAGCAGTCACCAAAGAATCTCAACACAAGAGAAACCAGAGAGCAGTGGGAGACCCTCCTTTGCCTAATGAGGGTTTAGTCTGCAACCCATATAGAACACTGCTTTGTATATCTGACTTTGGCACCACTTCTGCCCAAATCCCTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTG
  5   1   2       bld Neu0 FL                            IMAGE:6993680                                            GAGAGAAGAAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGGCTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAGGAGAAAGTGGGAGCTGTGCATGCAGAGAACCCAGAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGCACCCAGTGAAGAAGCAGCACAGTCAGGAAAGAGACGGGTAATAGAGAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAAGCAGATCTGACCCATGAAGCAGTCACCAAAGAATCTCAACACAAGAGAAACCAGAGAGCAGTGGGAGACCCTCCTTTGCCTAATGAGGGTTTAGTCTGCAACCCATATAGAACACTGCTTTGTATATCTGACTTTGGCACCACTTCTGCCCAAATCACTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTTGACTCCCAGTAGCTTATATGAGTGCAGCCTTTCAGCCCCCTCTCATGATGATGCAGCGTCCCCTGGGCAGCAGTACAGCCTTTAGTATAGACTCACTGATAGGGAGCCCACCACAGCCCAGCCCTGGACATTTTGTGTACACCGGATACCCCATGTTCATGCCTTACCCGGCCTGTGNATCTTGGCCCCCCTCCACCACCCCCTCCTCCAATCTCTTTTCTCAAGGCCAACTCTGGCAGCCCAAACTTCTCCCCTTTCAAGCGGCATCCCCCCAC
  5   1   2      seed Neu       out                  TNeu054d13.p1cSP6                                                    AAGCTGCACATCCAGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACTGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAGGAGAAAGTGGGAGCTGTGCATGCAGAGAACCCAGAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGAACCCAGTGAAGAAGCAGCACAGTCAGGAAAGAGACGGGTAATAGAGAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAAGCAGATCTGACCCATGAAGCAGTCACCAAAGAATCTCAACACAAGAGAAACCAGAGAGCAGTGGGAGACCCTCCTTTGCCTAATGAGGGTTTAGTCTGCAACCCATATAGAACACTGCTTTGTATATCTGACTTTGGCACCACTTCTGCCCAAATCCCTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCTTCCTTC
  5   1   2       bld HeRe                             EC2CAA43BC02.g1                                                                 AGGTCACCAAGGAAGAGAGGAGATCCCATTACACCGACAGCAATTGACAAGGTCCCGCCAAACAGACAGGAGCACGGATCTAACAGTACAGCCAGAGAGGAGAGACCCCATCCCAAACACAGAAGGAGCAAGTGGGAGCTGTGCATGCAGAGAACCCAGAAAAAGGCACCCAGGAAACAGAAAGTAAAGCAAAATTGTCACTCAGAGAGAGAGAAATGGACCTCAGCACCCAGTGAAGAAGCAGCAAAGCCAGGAAAGAGACGGGTAATAGAGAGACCCCCCACTATACAGGGACTCACTAAAGTTTGGAGAAGCAGATCTGACCCATGAAGCAGTCACCAAAGAATCTCAACACAAGAGAAACCAGAGAGCAGTGGGAGACCCTCCTTTGCCTAATGAGGGTTTAGTCTGCAACCCATATAGAACACTGCTTTGTATATCTGACTTTGGCACCACTTCTGCCCAAATCCCTGGCACTCTACCAATGGTAACTGTGGCAGACTGTGGCTCTGGTGCCTGCTGAGAGCTGCTCTAGTTGTTTGTGCCCAACTTTGGGAGCATTTTCTTAGCCCTTCCTTTGACTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)