Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 75%

 1012091355 Xt7.1-XZG35786.3 - 10 ESTs
                                                                       ....-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG35786.3                                             CAACTGTAAAGGGGAGATGAGCTACATGGCAAAGAAGTGTGGGGTTCGCTTTCAACCCCCTGCGATCATTCTGGTGTATGAAGATAAAGAAGCAGGAAAATCACGTCAGCGCATTATGCCTATCCGAAATTTCTCGAAATATTCAGATTGTAGCAGGGCAGCAGAACAGCTGAAAAACAACCCCCGCCACAAGGACTACCTAGATCTTGTCTCCCTAAGGCAGTTGGAAAAATTGTACAAGCTGTTGAAAGGGCACTTAAAGGGGGAAAGCTTGAAAGTCACCTTGGAAGAGATTAAGAAGGAAGAAACCATTGACCCAGAGGAAGACTTAAACAAACTGGATGACAAAGAGTTGGCCAAAAGGAAACACGTAATGGATGAGTTGTTTGAGAAGAACAGAAAGAAGAAAGATGACCCAGATTTTGAATACGAGATTGAGGTAGATTTTACAAAGGATGAACAAGCCGAGTCTTGTGGCTGGGATGATGCATCCGACGAAGGCTTTTGACTGTACAAATGATGTGTTCAAATCGATATACCAATGACAAAAGAAAAATCACCTTCCAAAGACGACTGTGAACCATTATCAGCCGAGGATATATCTGAGCTGCCCTTTTATTTACTATTTTTGCTTAGCCTCAGATATCTCCTAAACCAAACACTGAATATTTCTGTGCAAACTTATTTTATACATATTTAGCAAACACATTCTAAGTGTTTTCAAATACAGTACAAGTACTTTGTTTTCCCAAACTATGAGTTTATTCTAGGCTTAAGCATCAACAATTTCATCAGTAAAAGCTTTTAGAGAGGAGTATAATGGAATTGCTCTAATGAGCTAGCTGCATCTGCCATAGATGCCTTTTTATACACTACAAAATCATAGCACATAATTCCCCATTATAAGCCTGTTATATTTACTGTATTTCAGCAACAGTTTAAATCCTAAAGTGCAGAACAAAAAGAATATTAAATAAAAACAAACTGCTAACTGTTCTAGTGTACCACTGCCCACTGTTATGGAGCAGTGGTTGGGATCCCTGCAGGTCACATCCTTCTGACAATAACAGAAAGTGGTGCAACTTGCTCATTAAAGGAAAACTATAGCCTCAGAATGAATACTTAACCAACAGATTTTGTGTTAGGTGGCCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCGTTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGAGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTTCCTTCCACAACTGGAAGCAACCTGAAGTATTATTTATGTTGACACGAGGTGCACAAGAATTTTGATATCCACTGAGCAACATTGTGGGTATTGTGCAACAAACTATCACTTAAAAGAACACTAGCATGGAAACTTATAAAAAGGGCTCTGGCATCATTCATCCATATTACTATGTAAGATGCTAACCCCCATATCTAATAAAAGGCACTAAGATTGCTCAACCAGTAAATGCTACCTGCCGATTGGTTGTTATGGGTTACTGCTCCTGGGCAAACGTAGTGCCTTTCATTACATAACCCCATAAGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCGTGAAAGCACAATACTACAGGAACAGTAAGTCATATTATTGTAAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTCATTTTATTAAAATTAAATTGTATTTTTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008235982                                                   TAAAGGGGAGATGAGCTACATGGCAAAGAAGTGTGGGGTTCGCTTTCAACCCCCTGCGATCATTCTGGTGTATGAAGATAAAGAAGCAGGAAAATCACGTCAGCGCATTATGCCTATCCGAAATTTCTCGAAATATTCAGATTGTAGCAGGGCAGCAGAACAGCTGAAAAACAACCCCCGCCACAAGGACTACCTAGATCTTGTCTCCCTAAGGCAGTTGGAAAAATTGTACAAGCTGTTGAAAGGGCACTTAAAGGGGGAAAGCTTGAAAGTCACCTTGGAAGAGATTAAGAAGGAAGAAACCATTGACCCAGAGGAAGACTTAAACAAACTGGATGACAAAGAGTTGGCCAAAAGGAAACACGTAATGGATGAGTTGTTTGAGAAGAACAGAAAGAAGAAAGATGACCCAGATTTTGAATACGAGATTGAGGTAGATTTTACAAAGGATGAACAAGCCGAGTCTTGTGGCTGGGATGATGCATCCGACGAAGGCTTTTGACTGTACAAATGATGTGTTCAAATCGATATACCAATGACAAAAGAAAAATCACCTTCCAAAGACGACTGTGAACCATTATCAGCCGAGGATATATCTGAGCTGCCCTTTTATTTACTATTTTTGCTTAGCCTCAGATATCTCCTAAACCAAACACTGAATATTTCTGTGCAAACTTATTTTATACATATTTAGCAAACACATTCTAAGTGTTTTCAAATACAGTACAAGTACTTTGTTTTCCCAAACTATGAGTTTATTCTAGGCTTAAGCATCAACAATTTCATCAGTAAAAGCTTTTAGAGAGGAGTATAATGGAATTGCTCTAATGAGCTAGCTGCATCTGCCATAGATGCCTTTTTATACACTACAAAATCATAGCACATAATTCCCCATTATAAGCCTGTTATATTTACTGTATTTCAGCAACAGTTTAAATCCTAAAGTGCAGAACAAAAAGAATATTAAATAAAAACAAACTGCTAACTGTTCTAGTGTACCACTGCCCACTGTTATGGAGCAGTGGTTGGGATCCCTGCAGGTCACATCCTTCTGACAATAACAGAAAGTGGTGCAACTTGCTCATTAAAGGAAAACTATAGCCTCAGAATGAATACTTAACCAACAGATTTTGTGTTAGGTGGCCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCGTTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGAGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTTCCTTCCACAACTGGAAGCAACCTGAAGTATTATTTATGTTGACACGAGGTGCACAAGAATTTTGATATCCACTGAGCAACATTGTGGGTATTGTGCAACAAACTATCACTTAAAAGAACACTAGCATGGAAACTTATAAAAAGGGCTCTGGCATCATTCATCCATATTACTATGTAAGATGCTAACCCCCATATCTAATAAAAGGCACTAAGATTGCTCAACCAGTAAATGCTACCTGCCGATTGGTTGTTATGGGTTACTGCTCCTGGGCAAACGTAGTGCCTTTCATTACATAACCCCATAAGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCGTGAAAGCACAATACTACAGGAACAGTAAGTCATATTATTGTxxxAAxGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTCATTTTATTAAAATTAAATTGTATTTTTAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                  2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     4     6     3     6     3     6     3     6     3     6     4     6     3     6     4     5     4     5     3     4
                                               BLH ATG      16      30                                             
                                               BLH MIN      16      30                                             
                                               BLH MPR      16      30                                             
                                               BLH OVR      16      50                                             
                                               ORF LNG      16       4                                             
                                                                                                                                   PREDICTED = Sp ==== 2e-038     XP_788651.1 PREDICTED: hypothetical protein XP_783558 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED = Dr ==== 4e-047     NP_001028906.1 hypothetical protein LOC619252 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED = Gg ==== 2e-064     XP_422669.1 PREDICTED: similar to hypothetical protein MGC14126 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED = Hs ==== 9e-066     NP_116287.1 hypothetical protein LOC84984 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                   PREDICTED = Mm ==== 9e-066     NP_080168.1 hypothetical protein LOC66994 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG35786.3                                                             ATG------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TGA---------TGA---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------TAG---------TAA---------------------------------------------------------------TAG------------------------------------------------------------TAA---------------------TAA---------------TAA------TAG------------------------------------------------------------------------------------------------------------------ATG------TAA------------------------------------------------------------------------------------------------------------TGATAG---------------------TAA------TGATAG------------------------------------------------------TAA---TAA------------------------------------------------------------------------------------------------TGA------------------------------TGA------------------------------------------------------------------------------------------------ATGTAA------------------TAATAA------------------------TAAATG---------------------------------------------TAG------------------------------------------------------ATG---------------TGA------------------------------------------ATG---------------------TAA---------------------------TAA---------------TAA---TAA
                                                                   ORF                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2   12  bld Gas7 PIPE in                         XZG35786.5p TCTGTTTAAGCCAATGCAGTTCCTGGCACAGGAGTGAGCGTGCCCAACTGTAAAGGGGAGATGAGCTACATGGCAAAGAAGTGTGGGGTTCGCTTTCAACCCCCTGCGATCATTCTGGTGTATGAAGATAAAGAAGCAGGAAAATCACGTCAGCGCATTATGCCTATCCGAAATTTCTCGAAATATTCAGATTGTAGCAGGGCAGCAGAACAGCTGAAAAACAACCCCCGCCACAAGGACTACCTAGATCTTGTCTCCCTAAGGCAGTTGGAAAAATTGTACAAGCTGTTGAAAGGGCACTTAAAGGGGGAAAGCTTGAAAGTCACCTTGGAAGAGATTAAGAAGGAAGAAACCATTGACCCAGAGGAAGACTTAAACAAACTGGATGACAAAGAGTTGGCCAAAAGGAAACACGTAATGGATGAGTTGTTTGAGAAGAACAGAAAGAAGAAAGATGACCCAGATTTTGAATACGAGATTGAGGTAGATTTTACAAAGGATGAACAAGCCGAGTCTTGTGGCTGGGATGATGCATCCGACGAAGGCTTTTGACTGTACAAATGATGTGTTCAAATCGATATACCAATGACAAAAGAAAAATCACCTTCCAAAGACGACTGTGAACCATTATCAGCCGAGGATATATCTGAGCTGCCCTTTTATTTACTATTTTTGCTTAGCCTCAGATATCTCCTAAACCAAACACTGAATATTTCTGTGCAAACTTATTTTATACATATTTAGCANACACATTCTAAGTGTTTTCAAATACAGTACAAGTACTTTGTTTTCCCAACTATGAGTTTATTCTAGGCTTAAGCATNCACAATTTCATCAGTAAAAGCTTTTAGAGAGGAGTATA
  5   1   2   32  bld Tad5 5g                              XZT70209.5p ............................................CAACTGTAAAGGGGAGATGAGCTACATGGCAAAGAAGTGTGGGGTTCGCTTTCAACCCCCTGCGATCATTCTGGTGTATGAAGATAAAGAAGCAGGAAAATCACGTCAGCGCATTATGCCTATCCGAAATTTCTCGAAATATTCAGATTGTAGCAGGGCAGCAGAACAGCTGAAAAACAACCCCCGCCACAAGGACTACCTAGATCTTGTCTCCCTAAGGCAGTTGGAAAAATTGTACAAGCTGTTGAAAGGGCACTTAAAGGGGGAAAGCTTGAAAGTCACCTTGGAAGAGATTAAGAAGGAAGAAACCATTGACCCAGAGGAAGACTTAAACAAACTGGATGACAAAGAGTTGGCCAAAAGGAAACACGTAATGGATGAGTTGTTTGAGAAGAACAGAAAGAAGAAAGATGACCCAGATTTTGAATACGAGATTGAGGTAGATTTTACAAAGGATGAACAAGCCGAGTCTTGTGGCTGGGATGATGCATCCGACGAAGGCTTTTGACTGTACAAATGATGTGTTCAAATCGATATACCAATGACAAAAGAAAAATCACCTTCCAAAGACGACTGTGAACCATTATCAGCCGAGGATATATCTGAGCTGCCCTTTTATTTACTATTTTTGCTTAGCCTCAGATATCTCCTAAACCAAACACTGAATATTTCTGTGCAAACTTATTTTATACATATTTAGCAAACACATTCTAAGTGTTTTCAAATACAGTACAAGTACTTTGTTTTCCCAAACTATGAGTTTTATCTAGGCTTAAGCATC
  5   1   2       bld Gas7      in                         XZG35926.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATACCAATGACAAAAGAAAAATCACCTTCCAAAGACGACTGTGAACCATTATCAGCCGAGGATATATCTGAGCTGCCCTTTTATTTACTATTTTTGCTTAGCCTCAGATATCTCCTAAACCAAACACTGAATATTTCTGTGCAAACTTATTTTATACATATTTAGCAAACACATTCTAAGTGTTTTCAAATACAGTACAAGTACTTTGTTTTCCCAAACTATGAGTTTATTCTAGGCTTAAGCATCAACAATTTCATCAGTAAAAGCTTTTAGAGAGGAGTATAATGGAATTGCTCTAATGAGCTAGCTGCATCTGCCATAGATGCCTTTTTATACACTACAAAATCATAGCACATAATTCCCCATTATAAGCCTGTTATATTTACTGTATTTCAGCAACAGTTTAAATCCTAAAGTGCAGAACAAAAAGAATATTAAATAAAAACAAACTGCTAATTGTTCTAGTGTACCACTGCCCACTGTTACGGAGCAGTGGTTGGGATCCCTGCAGGTCACATCCTTCTGACAATAACAGAAAGTGGTGCAACTTGCTCATTAAAGGAAAACTATAGCCTCAGAATGAATACTTAACCAACAGATTTTGTGTTAGGTGGTCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCGTTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGTGAGTCTGTATTGTATATTAAAACTAACTGGGACAGGTCTACTGGCTCACACCCACTTTGATCTCTTTGCCC
  5   1   2       bld Tad5                                 XZT24867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAAAATCACCTTCCAAAGACGACTGTGAACCATTATCAGCCGAGGATATATCTGAGCTGCCCTTTTATTTACTATTTTTGCTTAGCCTCAGATATCTCCTAAACCAAACACTGAATATTTCTGTGCAAACTTATTTTATACATATTTAGCAAACACATTCTAAGTGTTTTCAAATACAGTACAAGTACTTTGTTTTCCCAAACTATGAGTTTATTCTAGGCTTAAGCATCAACAATTTCATCAGTAAAAGCTTTTAGAGAGGAGTATAATGGAATTGCTCTAATGAGCTAGCTGCATCTGCCATAGATGCCTTTTTATACACTACAAAATCATAGCACATAATTCCCCATTATAAGCCTGTTATATTTACTGTATTTCAGCAACAGTTTAAATCCTAAAGTGCAGAACAAAAAGAATATTAAATAAAAACAAACTGCTAACTGTTCTAGTGTACCACTGCCCACTGTTATGGAGCAGTGGTTGGGATCCCTGCAGGTCACATCCTTCTGACAATAACAGAAAGTGGTGCAACTTGCTCATTAAAGGAAAACTATAGCCTCAGAATGAATACTTAACCAACAGATTTTGTGTTAGGTGGCCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCGTTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGAGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTC
  3   1   2       bld Gas7 PIPE in                         XZG35786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAATAACAGAAAGTGGTGCACTTTGCTCATTAAAGGAAACTATAGCCTCAGAATGAATACTTAACCAACAGATTTTGTGTTAGGTGGCCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCGTTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGAGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTTCCTTCCACAACTGGAAGCAACCTGAAGTATTATTTATGTTGACACGAGGTGCACAAGAATTTTGATATCCACTGAGCAACATTGTGGGTATTGTGCAACAAACTATCACTTAAAAGAACACTAGCATGGAAACTTATAAAAAGGGCTCTGGCATCATTCATCCATATTACTATGTAAGATGCTAACCCCCATATCTAATAAAAGGCACTAAGATTGCTcaaccagtaaatgctacctgccgattggttgttatgggttactgctcctgggcaaacgtagtgcctttcattacataaccCCATAAGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCGTGAAAGCACAATACTACAGGAACAGTAAGTCATATTGTCTGAAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTCATTTTATTAAAATTAAATTGTATTTTTAAAAAAAAAAAAAA
  5   1   2      seed Gas7      in                         XZG24778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAACTATAGCCTCAGAATGAATACTTAACCAACAGATTTTGTGTTAGGTGGCCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCATTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGAGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTTCCTTCCACAACTGGAAGCAACCTGAAGTATTATTTATGTTGACACGAGGTGCACAAGAATTTTGATATCCACTGAGCAACATTGTGAGTATTGTGCAACAAACTATCACTTAAAAGAACACTAGCATGGAACCTTATAAAAAGGGCTCTGGCATCATTCATCCATATTACTATGTAAGATGCTAACCCCCATATCTAATAAAAGGCACTAAGATTGCTcaaccagtaaatgctacctgccgattggttgttatgggttactgctcctgggcaaacgtagtgcctttcattacataaccCCATAAGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCATGAAAGCACAATACTACAGGAACAGTAAGTCATATTATTGTCTGAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAAAATTTTTTAAATTAAAAT
  3   1   2       bld Gas7      in                         XZG35926.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATGAATACTTAACCAACAGATTTTGTGTTAGGTGGTCTATTAAAGAACCTTACCAAACTGGAAAACATATATATTTTTATACAGATTTACATTGTTNGGCGGTATCGTTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGTGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTTCCTTCCACAACTGGAAGCAACCTGAAGTATTATTTATGTTGACACGAGGTGCACAAGAATTTTGATATCCACTGAGCAACATTGTGGGTATTGTGCAACAAACTATCACTTAAAAGAACACTAGCATGGAAACTTATAAAAAGGGCTCTGGCATCATTCATCCATATTACTATGTAAGATGCTAACCCCCATATCTAATAAAAGGCACTAAGATTGCTcaaccagtaaatgctacctgccgattggttgttatgggttactgctcctgggcaaacatagtgcctttcattacataaccCCATAAGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCGTGAAAGCACAATACTACAGGAACAGTAAGTCATATTATTGTCTGAAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTCATTTTATTAAAATTAAATTGTATTTTTATCAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG24778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACTGGAAAACATATATATTTTTATACAGATTTACATTGTTTGGCGGTATCATTTTTCTTTAAGCTGATAGTTGCCTACAAATCTGTACTGGTAACAAAATTGATAGCAAGGGAGGCAGGCAGCAAATAAAGGAACATGTGTGAGAGTCTGTATTGTATATTAAAACTAACTGGAACAGGTCTACTGCTCAACACCCACTTTGATCTCTTTGCCCCAGACAGAAGTTCCTTCCACAACTGGAAGCAACCTGAAGTATTATTTATGTTGACACGAGGTGCACAAGAATTTTGATATCCACTGAGCAACATTGTGAGTATTGTGCAACAAACTATCACTTAAAAGAACACTAGCATGGAACCTTATAAAAAGGGCTCTGGCATCATTCATCCATATTACTATGTAAGATGCTAACCCCCATATCTAATAAAAGGCACTAAGATTGCTcaaccagtaaatgctacctgccgattggttgttatgggttactgctcctgggcaaacgtagtgcctttcattacataaccCCATAAGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCATGAAAGCACAATACTACAGGAACAGTAAGTCATATTATTGTCTGAAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTTAAATTAAAATTAAATTGTATTTTTCTC
  5   1   2      skin Gas       in                   TGas069j02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGATCATTTTTATTACTACAGCATTAGCATGAAAAAGGCTCTCTCGTGAAAGCACAATACTACAGGAACAGTAAGTCATATTGTCTGAAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTCATTTTATTAAAATTAAATTGTATTTTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas069j02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTACTACAGCATTAGCATGAAAAAGGCTCTCTCGTGAAAGCACAATACTACAGGAACAGTAAGTCATATTGTTTGAAAAATGTTTTTTCAACTGTCATTAAGATAAACATTTTTACTTCCATATATATTTTTGTAATATTTTTCATTTTATTAAAATTAAATTGTATTTTTAAGaaaaaaaaaaaaaaggaaaaaaaaaaaaaaaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)